ID: 1152267485

View in Genome Browser
Species Human (GRCh38)
Location 17:79304797-79304819
Sequence CTAAGATTCTCGGAAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152267480_1152267485 4 Left 1152267480 17:79304770-79304792 CCGGGGCCTCTGTTCTTGGTTCC 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 70
1152267481_1152267485 -2 Left 1152267481 17:79304776-79304798 CCTCTGTTCTTGGTTCCAACTCT 0: 1
1: 0
2: 2
3: 20
4: 269
Right 1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 70
1152267479_1152267485 5 Left 1152267479 17:79304769-79304791 CCCGGGGCCTCTGTTCTTGGTTC 0: 1
1: 0
2: 4
3: 34
4: 325
Right 1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152267485 Original CRISPR CTAAGATTCTCGGAAGGTGC TGG Intronic
900795445 1:4705483-4705505 CAAAGATTCTGGAAAGGAGCAGG + Intronic
904490249 1:30854210-30854232 CTACCATTGGCGGAAGGTGCAGG - Intergenic
905273113 1:36800036-36800058 CTAGGATTCTGGGAACCTGCTGG + Exonic
906595030 1:47068442-47068464 CGAAGATTCTGTGGAGGTGCTGG + Intronic
921702729 1:218285721-218285743 GTAAGTTTCTCGGTAGCTGCAGG - Intronic
1064552515 10:16519246-16519268 CTAAGAATCTCTGAATGTCCAGG + Intronic
1070842722 10:79498786-79498808 GTAAGATTCTCATAAGGAGCCGG - Intergenic
1071782962 10:88867070-88867092 CTAAGATTCTAGAAACTTGCAGG - Intergenic
1074777287 10:116775648-116775670 CTCGGATGCTGGGAAGGTGCTGG + Intergenic
1078854867 11:15198990-15199012 CTAACATGCTCGGAGGGTGGGGG - Intronic
1084106286 11:66982978-66983000 CCAGGATTCTGGGAAGGTGAAGG - Intergenic
1088141552 11:106622870-106622892 CTTATATTCTCGTAAGGTGGAGG - Intergenic
1091351745 11:134903369-134903391 CCAATATTCTAGGGAGGTGCTGG - Intergenic
1091936069 12:4435378-4435400 GTTAGATTCTCAGAAGGAGCAGG - Intronic
1092038394 12:5361790-5361812 CTATCATTTTCAGAAGGTGCTGG + Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099787164 12:87280517-87280539 CTAAGACACTCGCAAGGTGGTGG - Intergenic
1100594441 12:96059903-96059925 CTTAGATTCTCGCAACCTGCAGG + Intergenic
1103371175 12:120420737-120420759 CTCAGCTACTCGGAAGGTGGAGG - Intergenic
1104591010 12:130084697-130084719 CTACATTTCTGGGAAGGTGCTGG + Intergenic
1113360390 13:109625567-109625589 GTAAGATTCTTAGAAGCTGCTGG + Intergenic
1114070967 14:19106518-19106540 CTAAGACTCCCTGAAGGCGCAGG - Intergenic
1114091296 14:19293487-19293509 CTAAGACTCTCTGAAGGCTCAGG + Intergenic
1121262052 14:92573541-92573563 CTTAGATTCAAGGGAGGTGCTGG - Intronic
1122017165 14:98805845-98805867 CAGATTTTCTCGGAAGGTGCGGG + Intergenic
1134150910 16:11804240-11804262 CTGAGATTCTCAGCAGGAGCTGG + Intergenic
1135101459 16:19609913-19609935 CTGAGATTCACGGAAGGAACAGG + Intronic
1140304791 16:73792953-73792975 CGAACATTCTGGGAATGTGCAGG - Intergenic
1142045997 16:87925686-87925708 CCATGATTCTCGGAAGTTCCAGG - Intronic
1142632798 17:1236322-1236344 ACAAGATTCTAGGAAGGGGCCGG - Intergenic
1144403428 17:14929139-14929161 CAAAGATTCTCGGGAGATACCGG + Intergenic
1150586579 17:66523728-66523750 CTCAGATTGCCGGAAGATGCTGG + Intronic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1153769762 18:8405867-8405889 CTAGAATTCCCGGAAGGTTCTGG - Intronic
1157280690 18:46344727-46344749 GTCAGATTCTGGGAAGGTGAGGG + Intronic
1162834297 19:13306231-13306253 CAAAGATGCTCTGAAGGTCCCGG + Intronic
1166835318 19:45664149-45664171 CTAAACTTCTCCCAAGGTGCTGG + Intergenic
926620567 2:15043318-15043340 CTGAGATCCTTGGAAGGTGGAGG - Intergenic
932183997 2:69675889-69675911 CTCAGATTCTCGGGAGGTTGAGG + Intronic
934495575 2:94794431-94794453 CTCAGATACTCGGAAGGTTGAGG - Intergenic
940311429 2:152282983-152283005 ATAAGATTCTCAGAAGGTCCTGG - Intergenic
941959789 2:171242294-171242316 GTAAGTTTCTCTGAAGATGCAGG - Intergenic
946961507 2:224990451-224990473 CTAATATTCACGTAAAGTGCTGG + Intronic
1170310562 20:14986798-14986820 CTAAGATTCTGAGGAGGTGACGG - Intronic
1171769893 20:29314247-29314269 TTAAAATTCTCCAAAGGTGCAGG + Intergenic
1178627635 21:34231562-34231584 CTAACATTTACAGAAGGTGCTGG - Intergenic
1179889964 21:44330462-44330484 CTCAGATTCTCCGAGTGTGCCGG - Exonic
1184636017 22:45832229-45832251 CTAAGAATCCCTGAAGGAGCTGG + Intronic
950081360 3:10224533-10224555 ATAATATTCTTGGTAGGTGCAGG - Intronic
951011187 3:17681968-17681990 GTTAGATTCTCATAAGGTGCAGG - Intronic
952127974 3:30324432-30324454 CTAAGATTCTCAGAGGTAGCAGG + Intergenic
961065593 3:123872723-123872745 CTGAGATGCTGGCAAGGTGCTGG - Intronic
961320499 3:126070146-126070168 CTAAGATTCTTGGCAGGTCTTGG - Intronic
968797377 4:2716467-2716489 ATCAGATTCTGGGAAGGGGCCGG + Intronic
972821949 4:42711770-42711792 CTAAGATTTTAGGAAGCTGGAGG + Intergenic
976252300 4:83064994-83065016 CTAAGCTTCTGGGGAGGTGGAGG - Intronic
976412797 4:84735725-84735747 CTTAGATTCTGGGATGGTGAAGG + Intronic
976921322 4:90447435-90447457 CAAAAATTCTCTGAAGGGGCAGG + Intronic
979952172 4:126906771-126906793 GTGAGATTCTCCTAAGGTGCAGG - Intergenic
980070115 4:128234900-128234922 GTAAGATTCTGGGAAGGAGACGG + Intergenic
984002484 4:174267296-174267318 CTCAGCTTCTCGAAAAGTGCTGG - Intronic
986019856 5:3791021-3791043 CTAAGCTTCTGAGAAGGTTCTGG + Intergenic
993021804 5:82601062-82601084 CTAATATTCTAGGAAGGTGTGGG - Intergenic
994728311 5:103462407-103462429 CTAAGATTCTTGCAAGAGGCTGG - Intergenic
1001842999 5:174895430-174895452 ATTAGATTCTAAGAAGGTGCAGG + Intergenic
1007163263 6:39810105-39810127 ATAAGCTTCTCGGAAAGTCCTGG + Intronic
1007330164 6:41100856-41100878 CTAAGAATGTGGGAAGGTGGTGG + Intergenic
1012456250 6:99409250-99409272 CTTCGATTCTGGGGAGGTGCTGG + Exonic
1024659559 7:51479925-51479947 CTGAGAGTCTCAGAAGTTGCAGG + Intergenic
1027842254 7:83327904-83327926 ATAAAATTCTTGGAAGGGGCTGG + Intergenic
1040433727 8:47369138-47369160 CTAAGATTCTCACATTGTGCAGG + Intronic
1050744353 9:8858564-8858586 CTAAAATCCTCGTAACGTGCTGG + Intronic
1054957672 9:70931978-70932000 CTAACATTCTTGGAAGGTACAGG + Intronic
1198311651 X:135430656-135430678 GGAAGATTCTGGGAAGGTGGTGG + Intergenic