ID: 1152268042

View in Genome Browser
Species Human (GRCh38)
Location 17:79307597-79307619
Sequence TGCGTGAGGGTGTCTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 263}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152268042_1152268045 -10 Left 1152268042 17:79307597-79307619 CCTCCTGCAGACACCCTCACGCA 0: 1
1: 0
2: 2
3: 25
4: 263
Right 1152268045 17:79307610-79307632 CCCTCACGCATCGTTCCCCATGG 0: 1
1: 0
2: 1
3: 5
4: 78
1152268042_1152268055 14 Left 1152268042 17:79307597-79307619 CCTCCTGCAGACACCCTCACGCA 0: 1
1: 0
2: 2
3: 25
4: 263
Right 1152268055 17:79307634-79307656 GGTGGGCCACCCTGAGGCCTGGG 0: 1
1: 0
2: 6
3: 39
4: 305
1152268042_1152268054 13 Left 1152268042 17:79307597-79307619 CCTCCTGCAGACACCCTCACGCA 0: 1
1: 0
2: 2
3: 25
4: 263
Right 1152268054 17:79307633-79307655 CGGTGGGCCACCCTGAGGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 273
1152268042_1152268048 -4 Left 1152268042 17:79307597-79307619 CCTCCTGCAGACACCCTCACGCA 0: 1
1: 0
2: 2
3: 25
4: 263
Right 1152268048 17:79307616-79307638 CGCATCGTTCCCCATGGCGGTGG 0: 1
1: 0
2: 0
3: 11
4: 380
1152268042_1152268053 8 Left 1152268042 17:79307597-79307619 CCTCCTGCAGACACCCTCACGCA 0: 1
1: 0
2: 2
3: 25
4: 263
Right 1152268053 17:79307628-79307650 CATGGCGGTGGGCCACCCTGAGG 0: 1
1: 0
2: 3
3: 12
4: 170
1152268042_1152268047 -7 Left 1152268042 17:79307597-79307619 CCTCCTGCAGACACCCTCACGCA 0: 1
1: 0
2: 2
3: 25
4: 263
Right 1152268047 17:79307613-79307635 TCACGCATCGTTCCCCATGGCGG 0: 1
1: 0
2: 0
3: 6
4: 33
1152268042_1152268049 -3 Left 1152268042 17:79307597-79307619 CCTCCTGCAGACACCCTCACGCA 0: 1
1: 0
2: 2
3: 25
4: 263
Right 1152268049 17:79307617-79307639 GCATCGTTCCCCATGGCGGTGGG 0: 1
1: 0
2: 1
3: 0
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152268042 Original CRISPR TGCGTGAGGGTGTCTGCAGG AGG (reversed) Intronic