ID: 1152269043

View in Genome Browser
Species Human (GRCh38)
Location 17:79313178-79313200
Sequence CCTGGAAGGTGCCAGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 368}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152269043_1152269060 25 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269060 17:79313226-79313248 AATTATCAAAGGGGTAGGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 126
1152269043_1152269061 29 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269061 17:79313230-79313252 ATCAAAGGGGTAGGGCAGGCAGG 0: 1
1: 0
2: 2
3: 19
4: 247
1152269043_1152269050 1 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269050 17:79313202-79313224 TCTTGCATACCCCACTGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 81
1152269043_1152269047 -4 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269047 17:79313197-79313219 CAGGCTCTTGCATACCCCACTGG 0: 1
1: 0
2: 1
3: 13
4: 113
1152269043_1152269062 30 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269062 17:79313231-79313253 TCAAAGGGGTAGGGCAGGCAGGG 0: 1
1: 0
2: 1
3: 26
4: 362
1152269043_1152269051 2 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269051 17:79313203-79313225 CTTGCATACCCCACTGGGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 104
1152269043_1152269055 14 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269055 17:79313215-79313237 ACTGGGGTGGGAATTATCAAAGG 0: 1
1: 0
2: 1
3: 16
4: 122
1152269043_1152269048 -3 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269048 17:79313198-79313220 AGGCTCTTGCATACCCCACTGGG 0: 1
1: 0
2: 1
3: 12
4: 75
1152269043_1152269058 20 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269058 17:79313221-79313243 GTGGGAATTATCAAAGGGGTAGG 0: 1
1: 0
2: 1
3: 8
4: 139
1152269043_1152269049 -2 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269049 17:79313199-79313221 GGCTCTTGCATACCCCACTGGGG 0: 1
1: 0
2: 1
3: 4
4: 95
1152269043_1152269057 16 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269057 17:79313217-79313239 TGGGGTGGGAATTATCAAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 114
1152269043_1152269059 21 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269059 17:79313222-79313244 TGGGAATTATCAAAGGGGTAGGG 0: 1
1: 0
2: 0
3: 11
4: 159
1152269043_1152269056 15 Left 1152269043 17:79313178-79313200 CCTTGCTTCTGGCACCTTCCAGG 0: 1
1: 0
2: 4
3: 39
4: 368
Right 1152269056 17:79313216-79313238 CTGGGGTGGGAATTATCAAAGGG 0: 1
1: 0
2: 1
3: 19
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152269043 Original CRISPR CCTGGAAGGTGCCAGAAGCA AGG (reversed) Intronic