ID: 1152269846

View in Genome Browser
Species Human (GRCh38)
Location 17:79317866-79317888
Sequence ATCTTGTTCTTTATGTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152269843_1152269846 17 Left 1152269843 17:79317826-79317848 CCATCACTCGGCAGGCAAAGAGA 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1152269846 17:79317866-79317888 ATCTTGTTCTTTATGTGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 180
1152269842_1152269846 23 Left 1152269842 17:79317820-79317842 CCTGGGCCATCACTCGGCAGGCA 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1152269846 17:79317866-79317888 ATCTTGTTCTTTATGTGAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152269846 Original CRISPR ATCTTGTTCTTTATGTGAGC AGG Intronic
900811574 1:4805757-4805779 ATATTGTTCTTTATGTGCTCAGG + Intergenic
905437103 1:37964171-37964193 TTCTTGTTTTTTATTTGAGACGG - Intronic
907351705 1:53837565-53837587 ATCTTTTTTTTTTTTTGAGCCGG - Intronic
910672746 1:89789447-89789469 ATTTTGTTCTTTATGAGACAGGG - Intronic
911580733 1:99630529-99630551 ATCTGGCTATTTATGGGAGCAGG - Intergenic
917194641 1:172452480-172452502 TTTTTGTTTTTTATGTGAACAGG + Intronic
918508761 1:185286900-185286922 ATCGTGTTCTTGATCTGAGGAGG + Intronic
920361980 1:205425111-205425133 ATATGGTTCCTTATGTAAGCAGG - Intronic
921769399 1:219017534-219017556 GTCTTATTCTTTTGGTGAGCTGG - Intergenic
921786648 1:219238743-219238765 ATATTGTTGTTTATCTGTGCTGG - Intergenic
1062781181 10:209753-209775 ATCTTGTTCTTTATCTCAACAGG + Intronic
1063305270 10:4892961-4892983 ATGTTGTTCCTTATCTTAGCAGG + Intergenic
1066165997 10:32788788-32788810 ATCTTGTTATTTGTGGGAACTGG - Intronic
1070779750 10:79130576-79130598 ATCTTGGTCTGCATGTGTGCTGG - Intronic
1072099028 10:92211869-92211891 ATCTTTTTCTTTTTTTGAGACGG + Intronic
1072459116 10:95603454-95603476 ATCTTGATTTTTGTTTGAGCAGG + Intergenic
1074512054 10:114122505-114122527 ATATTGTGGTTTATTTGAGCTGG - Exonic
1075513443 10:123090736-123090758 ACCTTGTTCCAAATGTGAGCTGG - Intergenic
1079710374 11:23676140-23676162 ATCTTGTTCTTTTTATGGGCTGG - Intergenic
1080659313 11:34283218-34283240 ATCTTTTTCTTTTTTTGAGATGG + Intronic
1081449822 11:43160653-43160675 ATATTGTTCCTTATGTCAACAGG + Intergenic
1084929669 11:72544628-72544650 AACTTGTTCTTTATCTCAGAAGG + Intergenic
1085252946 11:75155459-75155481 ATCTTGTTCTTTTATTGAGACGG + Intronic
1091946670 12:4551188-4551210 TTCTTGCATTTTATGTGAGCTGG - Intronic
1093703730 12:22251887-22251909 ATTTTTTTGTATATGTGAGCAGG + Intronic
1095276644 12:40292321-40292343 TTCTTGTTGTTTATGTGAGTAGG + Intronic
1098506653 12:71260134-71260156 ACTTTGCTTTTTATGTGAGCTGG + Intronic
1099231166 12:80027262-80027284 TTCTTGGTCTCTATGTGAGCAGG + Intergenic
1103142442 12:118560514-118560536 AAATTGTTTTTTATCTGAGCTGG - Intergenic
1103438075 12:120942359-120942381 ATCAAGATGTTTATGTGAGCTGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104200256 12:126582137-126582159 ATGTCTTTCTTTATTTGAGCAGG + Intergenic
1106212847 13:27666883-27666905 ATCTTCTTCCTTTTGTGAACTGG - Intronic
1106304519 13:28497614-28497636 ATGTTCTTTTGTATGTGAGCAGG - Intergenic
1106398076 13:29400990-29401012 TTCTTCTTCTTTTTTTGAGCTGG + Intronic
1107303337 13:38990899-38990921 ATCTTTTTGTTTATGTTATCAGG - Exonic
1107758370 13:43650438-43650460 TACTTGTTTTTTGTGTGAGCAGG + Intronic
1109278994 13:60334057-60334079 ATCTAGTTCTTGCTGTGTGCAGG + Intergenic
1111957834 13:94777404-94777426 ATCATGTCCTTTTTGGGAGCAGG - Intergenic
1112861766 13:103836373-103836395 TTCCTGTTCTTTCTGTGAGTTGG + Intergenic
1113094304 13:106647539-106647561 ATTTTGTTCATTATTTGATCAGG + Intergenic
1113309866 13:109121146-109121168 ATTTTGATCATTATTTGAGCTGG - Intronic
1113614009 13:111668645-111668667 ATTTTGTGCTTCCTGTGAGCGGG + Intronic
1117791859 14:59350069-59350091 ATCTTGTTCTTTCTCAGTGCAGG - Intronic
1118067492 14:62207585-62207607 ATGTTGTTCTTTATGTGACAAGG + Intergenic
1118373148 14:65154611-65154633 ATCTTTCTTTTTCTGTGAGCTGG + Intergenic
1121294041 14:92802521-92802543 ATCTTGTTCTTTGTCTTAGAGGG + Intronic
1123924832 15:25097846-25097868 TTCCTGTACTGTATGTGAGCTGG - Intergenic
1126365387 15:47888820-47888842 ATATTGTTCTTTATGTGTGATGG + Intergenic
1126521887 15:49605260-49605282 ATCTGGTTCAGTATGTGGGCAGG + Intronic
1126566586 15:50107780-50107802 AACTTCTTCTTTATGTGTGTTGG - Intronic
1129627344 15:77215736-77215758 ATCTTTTTCTTTTTTTGAGATGG + Intronic
1130057713 15:80542786-80542808 ATCATTTTCTTTATGCCAGCTGG + Intronic
1132612952 16:826598-826620 CTCTTATTCTTTTTGTGAGACGG - Intergenic
1133695158 16:8256226-8256248 AATTTGCTCTTTTTGTGAGCTGG - Intergenic
1135802444 16:25510512-25510534 ATCTTCTTCATTATGGGAGCAGG - Intergenic
1138964951 16:62072855-62072877 TTCTTTTTCTTTATTTGAGACGG - Intergenic
1140288766 16:73630320-73630342 AACTTGTTCCTTCTGAGAGCAGG - Intergenic
1141776181 16:86123974-86123996 ATATTGATTTTTATGTGAACTGG - Intergenic
1142211606 16:88811225-88811247 TTCTTGTTCCTTCTGCGAGCTGG - Intronic
1142515759 17:427545-427567 TTTTTGTTCTTTATGTTTGCTGG - Intergenic
1143372890 17:6451313-6451335 GTCTTGATTTTGATGTGAGCTGG - Exonic
1146458017 17:33022116-33022138 AGATTCTTCTTTCTGTGAGCAGG + Intronic
1152269846 17:79317866-79317888 ATCTTGTTCTTTATGTGAGCAGG + Intronic
1155277426 18:24201925-24201947 ATCTTGTTCTTTTTTTCAGAGGG - Intronic
1155565093 18:27125699-27125721 ATTTTGTTCTTTCTCTGAGACGG + Intronic
1155925558 18:31651773-31651795 ATCTTTTTCTTTTTTTGAGATGG + Intronic
1156410115 18:36819889-36819911 ATGTTGTTCTTTTTATGAGGAGG - Intronic
1159373259 18:67557330-67557352 GCCTTATTCTTTATGTTAGCTGG + Intergenic
1159838326 18:73368213-73368235 AATTTGTTCTTTATGTGAGATGG - Intergenic
1168053149 19:53845246-53845268 TTCTTCTTCTTTATTTGAGATGG + Intergenic
1168234058 19:55050849-55050871 ATCTGGTTCTCTGTGTGAGAAGG + Intronic
1168556629 19:57348166-57348188 TTTTTGTTCTTTATGAGAGACGG + Intergenic
925786789 2:7439137-7439159 ACCTTCTTCTTCATGTCAGCAGG + Intergenic
926241353 2:11089229-11089251 TTCTTTTTCTTTTTGTGAGATGG - Intergenic
927102084 2:19795706-19795728 TTCTTGTTCTTTCTCTGAGTGGG - Intergenic
928350328 2:30546889-30546911 ATCTTATTCTTGTTATGAGCAGG - Intronic
928885139 2:36139700-36139722 ATCATGTTCCTTATGAGACCTGG - Intergenic
931064989 2:58575706-58575728 TTCTTGCTTTTTATTTGAGCTGG + Intergenic
931339991 2:61391322-61391344 AGCTTTTTCTTTAAGTGAGGAGG + Intronic
932247864 2:70212018-70212040 ATCTTGTGTTTTATATGAGAAGG - Exonic
932282015 2:70501595-70501617 CTCTTTTTCTTTTTTTGAGCAGG + Intronic
932968469 2:76507284-76507306 ATTTTGTTCATTTTGTGAGTGGG - Intergenic
935507094 2:103919149-103919171 ATTTTGTTCTTTATGTAATGGGG - Intergenic
938197965 2:129348164-129348186 ATCTTGTTGTCTTTGTGAGCAGG + Intergenic
939343926 2:140937704-140937726 ATCTTGTTTTCTATGTGATAAGG + Intronic
939416683 2:141908254-141908276 ATTATGTTCATTATGTGAACAGG - Intronic
939779503 2:146428163-146428185 TTCTTGTTCTCAATGTGTGCAGG - Intergenic
941086139 2:161120560-161120582 ATTTTTTTCTTTTTTTGAGCAGG - Intergenic
942800852 2:179873657-179873679 ACCTTTTTCTTTATGTCAGAGGG - Intergenic
943390307 2:187258657-187258679 ATCTTTTTCTTTCTGTGAAAAGG + Intergenic
1174282200 20:49447341-49447363 TTCTTGTTCTTTCTGTAACCTGG - Intronic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1177877157 21:26647657-26647679 ATCTTGTTCTTAATGTTGGGTGG - Intergenic
1179630619 21:42676002-42676024 ATCTGGTTGTTTATGTGTGAAGG + Intronic
951464494 3:22987582-22987604 ATCTTGTTCTTTAAGACAGAGGG + Intergenic
953514368 3:43575640-43575662 ATCTTTTTTTTTTTGTGAGACGG + Intronic
954345462 3:49993936-49993958 ATCTTTTTTTTTATTTGAGATGG - Intronic
955262800 3:57410946-57410968 ATCTTGTTCCTGATGTTAGTGGG - Intronic
955270538 3:57493935-57493957 ATCTTGTTCTTGATCTTAGAGGG - Intronic
956334086 3:68143948-68143970 AACATGCTCTTTATGTCAGCAGG + Intronic
958791996 3:98662535-98662557 ATCTTGTACTTTATTTTTGCTGG - Intergenic
959137049 3:102436006-102436028 ATATTGATTTTTATGTTAGCAGG - Intronic
959244480 3:103847184-103847206 AACATAATCTTTATGTGAGCAGG - Intergenic
959503526 3:107133320-107133342 ATCTTTTTTTTTTTTTGAGCCGG - Intergenic
960239401 3:115322767-115322789 ATTTTTTTCTTTATGTCAACGGG + Intergenic
960921315 3:122749612-122749634 ATCTTTTTCTTTTTTTGAGATGG + Intronic
961854175 3:129852755-129852777 GTATTGTTCTTTATGCTAGCCGG - Intronic
962979071 3:140471428-140471450 ACTTTTTTCCTTATGTGAGCTGG - Intronic
963540240 3:146577772-146577794 ATTTTGTTCTTTCTGTAATCTGG - Intronic
965052875 3:163673143-163673165 ATCTTTTCCTTTGTGTAAGCTGG + Intergenic
966577353 3:181517640-181517662 ATCTTTTTCTTTTTTTGAGACGG + Intergenic
969734660 4:8978949-8978971 ATATTGTTCTTAATGTCAGTAGG - Intergenic
970848911 4:20578099-20578121 ACATTGTTCTTTATGTGATCTGG + Intronic
972422396 4:38901282-38901304 CTCTTGTTTTTTTTTTGAGCTGG + Intronic
972428048 4:38953631-38953653 CTCTTATTCTCTATCTGAGCTGG + Intergenic
972754425 4:42030509-42030531 GTTTTGTACTTTATGTGAGCAGG + Intronic
975244946 4:72109555-72109577 ATCTGCTTCTTGAAGTGAGCAGG - Intronic
976528067 4:86116469-86116491 ATCTGGTTTTATATGTGAGATGG + Intronic
978129372 4:105176219-105176241 GTCTTGTTCTTGATCTTAGCAGG - Intronic
979291242 4:118981329-118981351 CTCTGGTTGTTTATGTGAGCAGG - Intronic
981577652 4:146222070-146222092 ATCTTTTCCTTTATGGCAGCTGG + Intergenic
981598476 4:146455745-146455767 ATCCTGTTCTTTATGTCTTCAGG + Intronic
982303294 4:153901958-153901980 ATTTTCTTCTTTATGTTTGCAGG - Intergenic
982516021 4:156350811-156350833 ATCTTGTTCTTTGTTTTACCTGG + Intergenic
985859055 5:2455911-2455933 ACCTTGTTTTCTGTGTGAGCTGG - Intergenic
986480616 5:8183277-8183299 ATCTTGGTGTTTTTATGAGCTGG + Intergenic
989261818 5:39427044-39427066 TTTTTTTTCTTAATGTGAGCAGG - Intronic
989996561 5:50839966-50839988 ATTTTGTTCTGTAAGTGAGATGG + Intronic
990902422 5:60767097-60767119 ATCTTTTTCTTTTTTTGAGATGG + Intronic
993086835 5:83373632-83373654 ATTTTCTTCTTCATGTGATCAGG - Intergenic
993168908 5:84390676-84390698 ATTATTTTCTTTATGTGAACTGG + Intergenic
993850413 5:93001000-93001022 TTCTTCTTCTTTTCGTGAGCTGG - Intergenic
994387964 5:99154633-99154655 ATGTTGTTCTCTATGTGTCCAGG - Intergenic
994915369 5:105969674-105969696 ATCTATTTCTATTTGTGAGCAGG + Intergenic
995092516 5:108194780-108194802 ATCTTCTTTTTTATGTTCGCTGG - Intronic
998255484 5:140584004-140584026 ATATTGTTCTTGATCTGAGGGGG - Intronic
998354561 5:141524226-141524248 ATCTTGTTCTTTATAACAGAGGG - Exonic
1001838762 5:174855227-174855249 AACTTGTTCTTTACGTTAGAAGG - Intergenic
1005388589 6:25310854-25310876 ATTTTGTTTTTTTTGTGATCTGG + Intronic
1008507975 6:52249189-52249211 AAATGGTTCTTTATGTAAGCAGG + Intergenic
1009225978 6:61020388-61020410 ATATTGCTCTTTATATGAGAAGG - Intergenic
1011390922 6:86852450-86852472 TTCTGGTTCTTTGTGTAAGCAGG + Intergenic
1012870493 6:104667573-104667595 ATCTTATTCTTTTTGTGAATGGG - Intergenic
1014283241 6:119465357-119465379 AAATTGTTCTTTATGTGTTCAGG - Intergenic
1019955197 7:4408807-4408829 ATATTTTTCTTTATTTGAGACGG + Intergenic
1020276568 7:6628249-6628271 ATCCTGCTGCTTATGTGAGCAGG + Intergenic
1020652724 7:10894722-10894744 GGCTTTTTCTTTAAGTGAGCTGG - Intergenic
1021812719 7:24419031-24419053 ATCTGGATCTTTATGTGAGAGGG - Intergenic
1022315666 7:29243057-29243079 ATTTTGTGTTTTCTGTGAGCTGG + Intronic
1022539057 7:31119300-31119322 ATCTTGTTCATTATGAGGACTGG + Intergenic
1023074498 7:36469697-36469719 TTCTTTTTCTTTTTTTGAGCTGG + Intergenic
1023342528 7:39236764-39236786 ATCTTTTTTTTTCTGTGAGTTGG - Intronic
1024287188 7:47768294-47768316 ATGTTATTCTGAATGTGAGCAGG - Intronic
1024428495 7:49258512-49258534 ATCTTGCTATTTATGACAGCGGG - Intergenic
1024755327 7:52523002-52523024 CTCTTGTTTTTTATGTAAGTAGG + Intergenic
1025251237 7:57352882-57352904 ACCTGGTCCTTTATGTGAGAAGG + Intergenic
1026925700 7:74191623-74191645 ATTTTGTTTTTTACATGAGCAGG - Intronic
1027705800 7:81531933-81531955 ATCTTGCTCTTTTCTTGAGCTGG - Intergenic
1027764720 7:82324962-82324984 ATCTTATTCATTGTATGAGCAGG - Intronic
1028026029 7:85841382-85841404 ATTTTCTTCTTTTTGTGTGCGGG - Intergenic
1029789815 7:102830485-102830507 ATCTGGTTCTATTAGTGAGCTGG - Intronic
1030732880 7:113010345-113010367 ATCTTGGTTTTAATCTGAGCAGG + Intergenic
1039343181 8:36673397-36673419 ATGTTGTTCTTGCTGTAAGCTGG + Intergenic
1041064687 8:54070716-54070738 ATTTTATTCTTTATTTGAGATGG - Intronic
1043916498 8:85928741-85928763 ATCATGTTCTATCTGTCAGCAGG - Intergenic
1043984177 8:86674381-86674403 ATTTTTGTCTTTATGTTAGCTGG + Intronic
1044130941 8:88524278-88524300 ATCTTATTATTTCTCTGAGCAGG - Intergenic
1044534987 8:93348211-93348233 CTCTTGTTTATTATGTGAGGGGG - Intergenic
1045746415 8:105427408-105427430 TCATTGTTCTTTCTGTGAGCTGG + Intronic
1046072208 8:109269850-109269872 ATAGAGTTGTTTATGTGAGCAGG - Intronic
1051510408 9:17871210-17871232 TTCTTGTTTTTTATATGAGGTGG - Intergenic
1052135167 9:24900207-24900229 ATCTTGTTCTTTATGTTTTGGGG - Intergenic
1052370764 9:27661926-27661948 ATCTTATTCTTTTTGAGAGGTGG - Intergenic
1052396831 9:27949133-27949155 ATCGTTTTCTTTATGCGAACAGG - Exonic
1053046183 9:34919880-34919902 ATCTTGTTCCTTTTATGGGCAGG + Intergenic
1055761579 9:79614429-79614451 ATTATGTTGTTTGTGTGAGCAGG + Intronic
1056780501 9:89545881-89545903 ATCTTATACTTTATGTGATGTGG - Intergenic
1058067826 9:100568420-100568442 ATAATGTTCTTTATGTTAGAAGG + Intronic
1060604333 9:124900308-124900330 TTCTTGTGCTGGATGTGAGCAGG - Intronic
1186039779 X:5463099-5463121 ATCCTGTGCTTTAGGAGAGCTGG + Intergenic
1186576646 X:10773801-10773823 CTCTTGGCCTGTATGTGAGCTGG - Intronic
1187314995 X:18184475-18184497 CTCTTGTTCTTTTTTTGAGACGG - Intronic
1189930903 X:46008984-46009006 ACCTTGTTCTTGATCTTAGCGGG + Intergenic
1190768906 X:53498894-53498916 ATCTTTTTCTTTTTGAGAGAGGG - Intergenic
1192253000 X:69429065-69429087 ATCTTGTTCTTGGTCTTAGCAGG - Intergenic
1192299562 X:69885976-69885998 CTCTGGATCCTTATGTGAGCAGG - Intronic
1194115229 X:89888558-89888580 ATCTTTTTCTTCATGTCAGAGGG + Intergenic
1194345700 X:92761793-92761815 ATTTTGTTTTTTATGGTAGCTGG + Intergenic
1196970126 X:121099497-121099519 AACTTGTTCTTTATTTTATCAGG - Intergenic
1197377227 X:125696006-125696028 CACTTGTTCTCTGTGTGAGCTGG - Intergenic
1200468020 Y:3545697-3545719 ATCTTTTTCTTCATGTCAGAGGG + Intergenic
1200897757 Y:8393840-8393862 ATCTTGTTATGTCTGTGACCTGG + Intergenic
1201268980 Y:12236146-12236168 ATTTGGTTCTTTATGTGAAGAGG - Intergenic
1201524905 Y:14921527-14921549 ATTATGTTTTTTATGTGAGGAGG + Intergenic