ID: 1152271081

View in Genome Browser
Species Human (GRCh38)
Location 17:79325232-79325254
Sequence TCCAGGGATGAGCCCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 231}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152271081_1152271093 10 Left 1152271081 17:79325232-79325254 CCCTGGGTGGGCTCATCCCTGGA 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1152271093 17:79325265-79325287 GTGGGTGAGGGCAGCCTGTGGGG 0: 1
1: 0
2: 2
3: 49
4: 425
1152271081_1152271085 -8 Left 1152271081 17:79325232-79325254 CCCTGGGTGGGCTCATCCCTGGA 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1152271085 17:79325247-79325269 TCCCTGGAGATTCCACAGGTGGG 0: 1
1: 1
2: 0
3: 15
4: 188
1152271081_1152271089 -2 Left 1152271081 17:79325232-79325254 CCCTGGGTGGGCTCATCCCTGGA 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1152271089 17:79325253-79325275 GAGATTCCACAGGTGGGTGAGGG 0: 1
1: 0
2: 0
3: 22
4: 213
1152271081_1152271092 9 Left 1152271081 17:79325232-79325254 CCCTGGGTGGGCTCATCCCTGGA 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1152271092 17:79325264-79325286 GGTGGGTGAGGGCAGCCTGTGGG 0: 1
1: 0
2: 4
3: 35
4: 418
1152271081_1152271094 15 Left 1152271081 17:79325232-79325254 CCCTGGGTGGGCTCATCCCTGGA 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1152271094 17:79325270-79325292 TGAGGGCAGCCTGTGGGGTGCGG 0: 1
1: 0
2: 5
3: 59
4: 609
1152271081_1152271096 25 Left 1152271081 17:79325232-79325254 CCCTGGGTGGGCTCATCCCTGGA 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1152271096 17:79325280-79325302 CTGTGGGGTGCGGCCTTCCCTGG 0: 1
1: 1
2: 1
3: 35
4: 250
1152271081_1152271084 -9 Left 1152271081 17:79325232-79325254 CCCTGGGTGGGCTCATCCCTGGA 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1152271084 17:79325246-79325268 ATCCCTGGAGATTCCACAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 159
1152271081_1152271091 8 Left 1152271081 17:79325232-79325254 CCCTGGGTGGGCTCATCCCTGGA 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1152271091 17:79325263-79325285 AGGTGGGTGAGGGCAGCCTGTGG 0: 1
1: 0
2: 7
3: 66
4: 614
1152271081_1152271088 -3 Left 1152271081 17:79325232-79325254 CCCTGGGTGGGCTCATCCCTGGA 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1152271088 17:79325252-79325274 GGAGATTCCACAGGTGGGTGAGG 0: 1
1: 0
2: 1
3: 47
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152271081 Original CRISPR TCCAGGGATGAGCCCACCCA GGG (reversed) Intronic
900375355 1:2351911-2351933 ACCTGGTATGAGGCCACCCACGG + Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
903012402 1:20340393-20340415 TCCCAGGATGACCCCAGCCAGGG - Intronic
903545367 1:24120627-24120649 TCCGGTGAGGAGCGCACCCATGG + Exonic
904048161 1:27621824-27621846 TGCAGGGACAAGCCCTCCCAGGG - Intronic
904973687 1:34439184-34439206 GCAAGGGATGGGCCCACCCAGGG - Intergenic
906248563 1:44294007-44294029 TGCAGGCATAAGCCCTCCCACGG + Intronic
906321669 1:44821088-44821110 ACCAGGAATGATCCCACCCCAGG - Intronic
907270662 1:53289007-53289029 TCCTAGGCTCAGCCCACCCAGGG + Intronic
907386045 1:54125879-54125901 TCCAGGAAGGAGGCCAGCCAGGG + Intergenic
907857438 1:58317675-58317697 TCCAGATAAGAGCCCAGCCAAGG + Intronic
908829028 1:68161865-68161887 TCCAGGGATGATCCCTTCCACGG + Intronic
912720667 1:112017281-112017303 TCCAGGGATGAGCCAAGGCCAGG + Intergenic
915324036 1:155071343-155071365 GCCAGGGCTGAGTCCACTCATGG + Intergenic
916126443 1:161575637-161575659 CCCAGAGATGAGCCTGCCCAGGG + Intergenic
916136362 1:161657477-161657499 CCCAGAGATGAGCCTGCCCAGGG + Intronic
917450017 1:175140326-175140348 TCCAGGGAGGGTCCCACGCATGG - Intronic
918238623 1:182603001-182603023 TCCACGGATGAGGGCACACAGGG - Intronic
922619221 1:226980165-226980187 TCCAGGGCAGAGCTCAGCCAGGG - Intronic
922904695 1:229165078-229165100 TCCAGGGCCGGGGCCACCCAAGG + Intergenic
923096209 1:230777319-230777341 ACCAGGGCTGAGCCTGCCCAAGG + Intronic
1064086203 10:12348683-12348705 TCGAAGGAGGAGCCCACCCGCGG - Intergenic
1069632069 10:69903073-69903095 TCCAGGGAGGAGACCGCCAATGG + Intronic
1072265939 10:93728094-93728116 TCCAGGACTGTGCCCACCCTTGG + Intergenic
1072359546 10:94646468-94646490 TCCAGGGATGATCCCTCCCATGG + Intergenic
1072801360 10:98394424-98394446 TCAAGGGATGAGCACACCCTCGG - Intronic
1073116489 10:101094509-101094531 TCCAGGGAGGAGGCCTCCCCGGG + Intronic
1074815200 10:117137415-117137437 TGGAGGGCTGAGCGCACCCAAGG - Intronic
1075776067 10:124989629-124989651 TCCAGGGATGATCCCTTCCATGG + Exonic
1075803252 10:125166315-125166337 TACAGTGCTGAGTCCACCCATGG + Intergenic
1076640338 10:131911628-131911650 TCCACGGATGAGCAAAGCCAAGG - Intronic
1077035193 11:491061-491083 TCCAGGCCTCAGCGCACCCAGGG - Exonic
1077412150 11:2408656-2408678 TCCAGGGTTGAGCCCTACAAGGG - Intronic
1077532278 11:3103000-3103022 TTGAGGGATGAGACCACCCTTGG + Intronic
1078335970 11:10463416-10463438 TCCAGGGATGAGCACACTGCTGG - Intronic
1079088630 11:17465031-17465053 CCCAGGGCTGAGCTCACCCGGGG + Intronic
1080666352 11:34339630-34339652 TCCAGGGATGATTCTACTCAGGG - Intronic
1081485380 11:43523134-43523156 TCCAGGGATGATCCCTTCCACGG - Intergenic
1082646745 11:55735561-55735583 TGGAGGGATGGGCCCACCCATGG - Intergenic
1083823838 11:65187305-65187327 TTCAGGGAAGGCCCCACCCAGGG - Intronic
1083866317 11:65455450-65455472 TTCAGGGATGAGGCCCTCCAGGG - Intergenic
1084251813 11:67905483-67905505 TCCTGGAATGAGGCCGCCCATGG + Intergenic
1084460433 11:69293958-69293980 GCCAGGGCAGAGCCCACACATGG - Intergenic
1084821025 11:71690545-71690567 TCCTGGAATGAGGCCGCCCATGG - Intergenic
1084839541 11:71833835-71833857 ACCAGGGATGACCCCACACCAGG + Intronic
1088110653 11:106257493-106257515 TCTAGGGTTCAGCCCACCTAAGG + Intergenic
1088457752 11:110050322-110050344 TCCTGGGATGAGTCTTCCCATGG + Intergenic
1089606798 11:119645998-119646020 TCCAGCGCAGAGCCCACCGAAGG - Intronic
1090030075 11:123198504-123198526 TCCAGGAATGCCCCCACTCATGG - Intergenic
1091243346 11:134069506-134069528 GCCTGGGAGGAGCCCACCCGGGG - Intronic
1091243367 11:134069558-134069580 GCCTGGGAGGAGCCCACCCGGGG - Intronic
1091294509 11:134464263-134464285 TCCAGGAATGAGCAAACCCTGGG - Intergenic
1091705146 12:2688642-2688664 TCCTGGGCTGAGACCACCCCCGG + Exonic
1092422083 12:8340274-8340296 TCCTGGAATGAGGCCGCCCATGG + Intergenic
1093489425 12:19688072-19688094 TCCAGTGATCGGCCCACCCCAGG - Intronic
1093870396 12:24284299-24284321 TCCAGGGATCAGCCTACACCAGG - Intergenic
1096064175 12:48725998-48726020 TCTACTGATGAGCCCACCAAAGG - Intergenic
1096469347 12:51866261-51866283 TTCAGGGATTGGCCCACCCTGGG - Intergenic
1097038050 12:56137087-56137109 TGTAGAGATGAGCCCAGCCAGGG + Intronic
1100547047 12:95613230-95613252 GCCAGGGATGAGGCCAGGCAGGG + Intergenic
1101588779 12:106108350-106108372 TCCAGCCATGGGTCCACCCAGGG - Intronic
1101941798 12:109104720-109104742 GCCAGGGATGAACACACCCCTGG - Intronic
1102328859 12:112012798-112012820 TCCTGGGATCCGCCCAGCCAAGG - Intronic
1104039533 12:125120708-125120730 TCCAGGGATGAAGCATCCCAGGG + Intronic
1104224000 12:126813336-126813358 TCCAGGCATTAGAACACCCAAGG - Intergenic
1115300354 14:31878598-31878620 TCAAGCGATGGGCCCCCCCATGG + Intergenic
1117231556 14:53724581-53724603 TACAGGCATGAGCCTACCCCTGG + Intergenic
1118357779 14:65029468-65029490 TTCAGAGATGAGCCTACTCAAGG + Intronic
1121453365 14:94023417-94023439 TACAGGGAGGAGCCCCACCAAGG - Intergenic
1121581845 14:95037611-95037633 TCCAAGGCTGACCCCACCCTGGG - Intergenic
1121769404 14:96519201-96519223 TACAGGGGTGAGCCCACACCTGG + Intronic
1121992551 14:98573764-98573786 TCCAGGAGTGAGTCCACCCATGG - Intergenic
1123059274 14:105587136-105587158 TCCCGGCAGGAGCCCAGCCAGGG - Intergenic
1123074577 14:105661585-105661607 TCCAGCGGCGAGCCCTCCCACGG + Intergenic
1123083606 14:105707367-105707389 TCCCGGCAGGAGCCCAGCCAGGG - Intergenic
1123158774 14:106257304-106257326 TCAAGTGATCAGCCCACCTATGG + Intergenic
1123196020 14:106617453-106617475 CCCAGGGCTGAGCACACACAGGG + Intergenic
1202869564 14_GL000225v1_random:148090-148112 TGCAGGGATGATCCCTTCCATGG - Intergenic
1123912119 15:24978209-24978231 ACCTGGTATGAGACCACCCATGG + Exonic
1124193167 15:27597962-27597984 TCCTGGGATGGGCCCACCAATGG - Intergenic
1124941357 15:34221472-34221494 TACAGGCATGAGCCCACACCTGG - Intergenic
1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG + Exonic
1130554776 15:84915017-84915039 TGCAGGGATGGGCCCACGCCAGG - Intronic
1130853289 15:87819067-87819089 TCCAGGGCTGAGCCCATTAATGG - Intergenic
1132409068 15:101562857-101562879 TCCTGGAATGAGGCCACCCATGG + Intergenic
1133069731 16:3237365-3237387 TCCAGTGATCAGCCCACCTCTGG - Intergenic
1133071345 16:3248745-3248767 TACAGGGATGAGCTTACCCTTGG + Intronic
1133210285 16:4259935-4259957 TCCAGGGACGGGGCCCCCCAAGG + Intronic
1133261188 16:4551371-4551393 TCCAAGCATGAGGTCACCCAAGG + Intergenic
1133460410 16:5982234-5982256 TCCAGGGATGTTCCCACCATAGG + Intergenic
1133891132 16:9880130-9880152 TCCAGATATGAGCCCAGCCTGGG - Intronic
1134062391 16:11206890-11206912 TCAAGAGATGAGACCACTCAGGG - Intergenic
1134640580 16:15826629-15826651 TCCAGGGCTCAGTCCACTCAGGG + Intronic
1138204306 16:55113743-55113765 CCCAGGGCTGAGCCCAGCCAGGG - Intergenic
1141882809 16:86871097-86871119 GCCATGGCTGTGCCCACCCAGGG + Intergenic
1143771801 17:9173742-9173764 TCCAGGGTTCAGCCCTCCCTGGG + Intronic
1144750293 17:17643918-17643940 TCCAGGGATCAAACCAACCATGG - Intergenic
1145752034 17:27361935-27361957 CCTAGGGATGATCCCAGCCATGG - Intergenic
1149629976 17:58114654-58114676 CCCAGGAGTGAGCCCAGCCATGG - Intergenic
1151536523 17:74741974-74741996 TCCAGGGATCAGGCAGCCCAGGG - Intronic
1152271081 17:79325232-79325254 TCCAGGGATGAGCCCACCCAGGG - Intronic
1152465494 17:80464079-80464101 GCTGGGGATGAGCCCACCCCCGG + Intergenic
1152584105 17:81181483-81181505 TCCAGGGAAGACCCCGCCCTGGG - Intergenic
1152923362 17:83076884-83076906 TCCAGGGACAAACACACCCAAGG + Intergenic
1152961809 18:84480-84502 TCCAGGCAGGAGCCCAGCCCTGG + Intergenic
1153280179 18:3407577-3407599 TACAGGCATGAGCCCACGCCTGG - Intergenic
1153621365 18:6981329-6981351 CCCAGGTAGGAGCCCACCCTAGG - Intronic
1155374202 18:25138161-25138183 TCCAGGGCTGATACCTCCCAGGG + Intronic
1158746985 18:60212426-60212448 TCCTGGGATGAACACACTCATGG + Intergenic
1160414382 18:78697938-78697960 TCCATGGATCAGCCCACCCATGG + Intergenic
1160906939 19:1455988-1456010 CCCTGGGATGACCCCACCCTGGG - Intronic
1161435440 19:4260015-4260037 TCCAGGCATGAGCCCCACCAAGG + Intronic
1161983575 19:7642694-7642716 GCCATGGGTGAGCCCACTCAGGG - Intronic
1162908288 19:13836230-13836252 TCCAAGCATCAGCCCACCCAGGG + Intergenic
1163162842 19:15475821-15475843 TCCAAGGATGACCCCATCCAGGG + Exonic
1165161781 19:33820667-33820689 CCCGGGGATGGACCCACCCATGG - Intergenic
1165541645 19:36497024-36497046 TCCAGGGATGATTCCTTCCATGG + Intergenic
1166651760 19:44580503-44580525 TCCAGGGCTCACCCCAGCCATGG + Intergenic
1166738976 19:45102865-45102887 TCCAGGGCTGAGCCCACGTCAGG + Intronic
1167297403 19:48659735-48659757 TTCAGAGATGACCCCACCCTGGG + Intergenic
926767199 2:16331920-16331942 GCCAGGGAGCAGCCCACCCTGGG - Intergenic
926914575 2:17879380-17879402 TGCAGGGAAGAGCGAACCCAGGG + Intronic
928103056 2:28450521-28450543 ATCAGGAAGGAGCCCACCCAGGG + Intergenic
928296057 2:30085106-30085128 TGCAGGGAGGAAACCACCCAAGG + Intergenic
930065622 2:47325344-47325366 TCCCGGGCTCAGCCCACACAGGG - Intergenic
934525317 2:95048250-95048272 TCCAAGGCTGAGCCTGCCCAGGG + Intronic
934774200 2:96926947-96926969 TCCAGGGATGCCTCCATCCAGGG - Intronic
935627813 2:105185559-105185581 TGCAGGGGTGTGCCCACCCCTGG - Intergenic
935945280 2:108280589-108280611 TCTGGGGATAAGCACACCCAGGG - Intergenic
936831533 2:116653762-116653784 TTCACTGAAGAGCCCACCCAAGG - Intergenic
937821239 2:126313427-126313449 TGCAGGGATGAGTCCAACCAGGG - Intergenic
942787677 2:179719164-179719186 TCCACCCATGAGCCCACCCCAGG + Intronic
945477568 2:210303608-210303630 GCCAGGGATGACCCCACTCAGGG - Intronic
947700988 2:232233716-232233738 GCCAGGAATGAGCACAACCAGGG - Intronic
947751620 2:232535571-232535593 GCCAGGGAGGAGGCCACTCAGGG + Exonic
948042070 2:234910376-234910398 TTCCTGGATGAGCTCACCCAAGG + Intergenic
948133079 2:235615207-235615229 TCCAGGGACGTCCCCACCCTCGG + Intronic
948946534 2:241223428-241223450 CCCAGGGATGAGGCCAGGCAGGG - Intronic
1168957494 20:1844625-1844647 ACCAGGGATGTGCCCACCTCAGG - Intergenic
1170528000 20:17260383-17260405 GCCATGGCTGAGCCCACCAAGGG + Intronic
1172275597 20:33677244-33677266 CCCAGGGCTGATCCCACCTACGG + Exonic
1175936977 20:62518426-62518448 TCCAGGGCTGGGCCCCCCAAGGG + Intergenic
1176004199 20:62850838-62850860 TCGAGGGAGGCGCCCAACCAAGG - Intronic
1178898970 21:36583907-36583929 CACAGGGATGAGCCCATCCTTGG - Intergenic
1178960502 21:37060363-37060385 CCCCAGGATGTGCCCACCCATGG + Intronic
1179469207 21:41599312-41599334 TGCAGGGAGGAGCCCAGACAGGG + Intergenic
1180799722 22:18626084-18626106 TCCAGAGATGCCACCACCCAGGG + Intergenic
1181050662 22:20236864-20236886 TCCAGGGCTGGGCCCAAGCAGGG + Intergenic
1181221993 22:21369182-21369204 TCCAGAGATGCCACCACCCAGGG - Intergenic
1182085035 22:27555621-27555643 TCCAGGGATGGCCCCACCACAGG + Intergenic
1182255132 22:29032357-29032379 TCCAGAGATGAGCACACGCAGGG + Intronic
1182462074 22:30490307-30490329 TCCAGGGATGCACCCATGCAGGG - Intronic
1183606616 22:38870288-38870310 TACAGGGCTGAGCCCCCACATGG - Intronic
1183663688 22:39235455-39235477 TCCAGGTGTGGGCCCAGCCAGGG - Intronic
1184418371 22:44364893-44364915 TCCAGGGCTGGGCCTGCCCAGGG - Intergenic
1184438306 22:44493828-44493850 GCCAGGGTGGTGCCCACCCAAGG + Exonic
1185348445 22:50320949-50320971 GCCAGGGGTCAGGCCACCCAGGG + Intronic
1185408476 22:50671082-50671104 TCCAGGGAAGTGGTCACCCAGGG + Intergenic
952027323 3:29099126-29099148 TCCAGGGATGCCCACTCCCAGGG - Intergenic
952557985 3:34555813-34555835 TCCAGGGACAACCCTACCCATGG + Intergenic
952774550 3:37032177-37032199 TCCAGGGATTTACCCATCCATGG + Intronic
952953768 3:38544068-38544090 GCCAGGGAAGACCCCACCCAAGG + Intergenic
953751305 3:45610490-45610512 TCCAGGGACTAGCTCACCAAAGG + Intronic
954525856 3:51270678-51270700 GCCAGGGAGGAGCCCACCGAAGG + Intronic
956837909 3:73110720-73110742 TCCAGGGTTGACTCCACCCCCGG - Intergenic
959735638 3:109654996-109655018 TTCAGGGTGGAGCCCTCCCAGGG - Intergenic
961042390 3:123686519-123686541 AGGAGGGATGAGCCAACCCAGGG - Intronic
961400129 3:126634741-126634763 TGCAGGGGTCAGCCCAGCCAGGG + Intronic
961899828 3:130199797-130199819 TCCTGGAATGAGGCCACCCATGG + Intergenic
961998366 3:131269830-131269852 TTCAGGAAGGAGCCCACACATGG + Intronic
962106627 3:132396544-132396566 TCCAGGGATGAGCTCCCTCTGGG + Intergenic
962682621 3:137815650-137815672 TGGATGGATGAGCCCACCCAGGG - Intergenic
968065656 3:195757603-195757625 TCCTGGTGTGAGCCCAGCCAGGG - Intronic
968494221 4:906616-906638 CCCAGGGATGATGCCACACATGG - Intronic
968497314 4:925990-926012 CCCAGTGGTGAGCCCACCCGGGG + Intronic
968497374 4:926180-926202 CCCAATGGTGAGCCCACCCATGG + Intronic
968744830 4:2354152-2354174 TCCCAGGCTGAGCCCACACATGG - Intronic
968950314 4:3688007-3688029 TCCAGAGTTCAGCCCACCTAGGG - Intergenic
969010485 4:4057953-4057975 TCCTGGAATGAGGCCGCCCATGG + Intergenic
969298838 4:6285383-6285405 TCCAGGGATGGGGGCATCCAGGG + Intronic
969351893 4:6603002-6603024 TCTAGGGATCAGCCCATACAAGG - Intronic
969723829 4:8907692-8907714 TCCAGGGAACAGCCAAGCCAAGG + Intergenic
969802974 4:9584043-9584065 TCCTGGAATGAGGCCGCCCATGG - Intergenic
969871761 4:10109087-10109109 TCCACTGAGGGGCCCACCCAGGG - Intronic
973925569 4:55734165-55734187 TCCAGGCAGGAGTCCACCTAAGG - Intergenic
977201189 4:94119000-94119022 TACATGATTGAGCCCACCCAAGG - Intergenic
982383687 4:154777272-154777294 TCCAGGGAAGATGCCATCCATGG + Intergenic
985886135 5:2680742-2680764 CCAAGGAATGAGCCCACCCAGGG - Intergenic
985907915 5:2855627-2855649 TCCAGGTGTGTGCTCACCCACGG - Intergenic
986974742 5:13381837-13381859 CACAGGGTTGTGCCCACCCATGG - Intergenic
994134695 5:96272356-96272378 TCAAGGGAAGTGCCCACCCAGGG + Intergenic
994232363 5:97322702-97322724 GCCAGGGATGATGCCACCTAAGG - Intergenic
994336882 5:98577127-98577149 TCCAGGGATGATCCCTTCCATGG - Intergenic
997299123 5:132789517-132789539 ACAAACGATGAGCCCACCCAAGG + Intronic
998127774 5:139635882-139635904 TTCAGGCCTGGGCCCACCCAAGG - Intergenic
999436310 5:151566227-151566249 GCCAGGGATCAGCCCAGCAAAGG - Exonic
999603222 5:153289880-153289902 TCCAGGCATGAGCCACCACATGG + Intergenic
1002139959 5:177132661-177132683 CCCAGCGCTGAGCCCACCCCCGG - Intergenic
1002412040 5:179088284-179088306 TCTACTGATGAGCCCACCAAAGG + Intergenic
1002441303 5:179265796-179265818 TTCAGGGCTGAGCGCACCCTTGG - Intronic
1002470195 5:179430429-179430451 TCCAGGCAGGAGCTCATCCAAGG + Intergenic
1002493965 5:179599423-179599445 CCCAGGGATGACCCGACCCTGGG - Intronic
1002718251 5:181242297-181242319 ACCAGGGATGAGACCAACTATGG - Exonic
1003119528 6:3308290-3308312 TCCAGGGCTAAGCCCTCCCTGGG + Intronic
1003131863 6:3401771-3401793 ACCAGAGCTGAGCTCACCCAGGG - Intronic
1006440390 6:34050154-34050176 GCCAGGCATGAGCCCACCCCAGG + Intronic
1006545002 6:34773447-34773469 TCCTGGAATGAGGCCGCCCATGG + Exonic
1011980585 6:93371221-93371243 TCCATGGATTAACCCAACCATGG + Intronic
1014331744 6:120076222-120076244 ATCAGGGATGAGCACACACAAGG + Intergenic
1016183522 6:141175220-141175242 TCCAGGGATGAGCTCCCTCTGGG + Intergenic
1016597196 6:145815318-145815340 TCCAGGGCTGAGCTCTCCCGGGG - Intergenic
1016601504 6:145866720-145866742 TCCAGGGAGGAGGCCACTTATGG + Intronic
1018870279 6:167777424-167777446 TCCACCCATGACCCCACCCATGG + Intergenic
1019616647 7:1965966-1965988 CCCAGGCATGGGCCGACCCAGGG - Intronic
1019866093 7:3711856-3711878 ACCAGGGAGGAGCCCTGCCATGG + Intronic
1025995050 7:66522685-66522707 GCCAGGGCAGAGCCTACCCAAGG + Intergenic
1026096020 7:67347125-67347147 TCCAGGAGTCAGCCCACCTATGG + Intergenic
1029069769 7:97885954-97885976 TCCTGGAATGAGGCCGCCCATGG + Intergenic
1029106211 7:98178546-98178568 TCCAGGGATGAGGCTACCAGTGG - Intronic
1029655732 7:101923178-101923200 TCCAGGGAGGACCCCACGCTGGG - Intronic
1031179795 7:118399662-118399684 TCCAGTGCTGAGCCCAGCAAAGG - Intergenic
1032128346 7:129210688-129210710 CCCAGGCATCAGGCCACCCAAGG - Intronic
1032491446 7:132327255-132327277 TCCAGGCATGAGCAGACCCAAGG - Intronic
1033344801 7:140518555-140518577 TCCAGGGAAGAGCCCAGCCTCGG + Exonic
1035231782 7:157469847-157469869 TCCAGAGTTGACCCCACCCCGGG - Intergenic
1035294832 7:157861149-157861171 TCCAGGGATGTGCCAGCTCAGGG + Intronic
1035295345 7:157864270-157864292 TCCAGGGTCCAGCCCACCCGAGG + Intronic
1035672697 8:1432402-1432424 TCTGGGGATTAGCCCAACCAAGG + Intergenic
1036248783 8:7143733-7143755 TCCTGGAATGAGGCCACCCATGG - Intergenic
1036252018 8:7170621-7170643 TCCTGGAATGAGGCCGCCCATGG + Intergenic
1036273958 8:7334174-7334196 TCTCAGGATGAGCCCACACATGG + Intergenic
1036347388 8:7976174-7976196 TCTCAGGATGAGCCCACACATGG - Intergenic
1036365472 8:8116840-8116862 TCCTGGAATGAGGCCGCCCATGG - Intergenic
1036842143 8:12132204-12132226 TCTCAGGATGAGCCCACACATGG - Intergenic
1036842696 8:12136959-12136981 TCTCAGGATGAGCCCACACATGG - Intergenic
1036863972 8:12378454-12378476 TCTCAGGATGAGCCCACACATGG - Intergenic
1037227986 8:16618919-16618941 TCTACTGGTGAGCCCACCCAAGG + Intergenic
1047597227 8:126391111-126391133 TCCAGGGATCAGCAAATCCAAGG - Intergenic
1047688424 8:127324701-127324723 TCTAGTGATGAGCCCATCAAAGG - Intergenic
1048180414 8:132189278-132189300 CCCAGGGATGAGATCACACAAGG - Intronic
1048874531 8:138826764-138826786 TCCAGGGATGTGTTCCCCCAAGG - Exonic
1049044688 8:140140102-140140124 TGCAGGGGTGAGCACACGCAGGG + Intronic
1049835011 8:144729972-144729994 GGCAGGGCTGAGCCCACCCAGGG + Intronic
1056515552 9:87345865-87345887 TCCAGGAAGGAGCTGACCCAGGG + Intergenic
1057481482 9:95448389-95448411 TTCAGGGCTGAGCCCATCCCAGG + Intronic
1058902657 9:109455943-109455965 CCCAGGAATGAGTCCACACAAGG - Intronic
1060077748 9:120608547-120608569 TCAGTGGATGAGGCCACCCATGG - Intronic
1060799155 9:126532722-126532744 GCCAGGAATGTGCACACCCAGGG + Intergenic
1061679793 9:132237351-132237373 CCCAGGGAAGAGCCCAGCAAAGG - Intronic
1061960615 9:133987117-133987139 TCCAGGTCTGAGCCCCTCCAAGG - Intronic
1062014670 9:134285093-134285115 CCCAGGGAGCAGACCACCCAGGG - Intergenic
1062115653 9:134806736-134806758 TCCTAGGAAGAGCCCAGCCATGG - Intronic
1062278409 9:135741310-135741332 AGCAGGGAGGAGCCCAGCCAGGG + Intronic
1062522877 9:136965891-136965913 TGAAGGGCTGTGCCCACCCATGG + Intergenic
1062736337 9:138139624-138139646 TCCAGGCAGGAGCCCAGCCCTGG - Intergenic
1203735310 Un_GL000216v2:133051-133073 TCCAGGGATGATCCCTTCCATGG + Intergenic
1187569357 X:20485421-20485443 GCCAGGGATGAGCTGACCAAGGG - Intergenic
1188180007 X:27043778-27043800 TCTACTGATGAGCCCACCAAAGG + Intergenic
1190063063 X:47223166-47223188 TGCAGTGATGGGCCCAGCCATGG - Exonic
1195828525 X:109029578-109029600 TCCAGTGGCAAGCCCACCCATGG + Intergenic
1199029824 X:142984318-142984340 TCCTGCCATGAGCCCACACAAGG + Intergenic
1199494018 X:148433036-148433058 TCCAGGAAGGAGCCTACTCAGGG - Intergenic
1200398572 X:156005729-156005751 TCCAGGCAGGAGCCCAGCCCTGG - Intronic
1202625707 Y:56855356-56855378 TCCAGGGATGATCCCTTCCATGG - Intergenic