ID: 1152274140

View in Genome Browser
Species Human (GRCh38)
Location 17:79344475-79344497
Sequence ATTGAGAAGCCCAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152274140_1152274142 -7 Left 1152274140 17:79344475-79344497 CCTTCCTCATTGGGCTTCTCAAT 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1152274140_1152274143 -3 Left 1152274140 17:79344475-79344497 CCTTCCTCATTGGGCTTCTCAAT 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG 0: 1
1: 0
2: 1
3: 34
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152274140 Original CRISPR ATTGAGAAGCCCAATGAGGA AGG (reversed) Intronic
901227578 1:7623043-7623065 CTTGAGAAGGCCTCTGAGGATGG - Intronic
901473772 1:9475225-9475247 ATTGAGCAACCCAAGGAAGAGGG + Intergenic
902079151 1:13809302-13809324 AGTGAGAAGTCCAGTGAGGAAGG + Intronic
905140597 1:35840856-35840878 CTTTAGAAGGCCAAGGAGGAAGG - Intronic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905930459 1:41783258-41783280 AGTGAGAAGCCACAGGAGGAAGG + Intronic
906433119 1:45772228-45772250 CTTGGGAAGCCCAAGGTGGATGG - Intergenic
915023878 1:152807885-152807907 AGTGAGAATTCCAATGATGATGG - Intronic
916975783 1:170075893-170075915 AATAGGAAGTCCAATGAGGAAGG - Intronic
917670688 1:177270701-177270723 AGTGAAAAACCCAATGACGACGG + Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
921066182 1:211623627-211623649 AATGGAAAGCCCCATGAGGACGG + Intergenic
921108295 1:212006353-212006375 ATTGAGAAGCCCAATTACATTGG - Intronic
922490519 1:226012845-226012867 ATAGAAAAGTCCAATGAGAAGGG + Intergenic
923192520 1:231633515-231633537 ATGTGGAAGCCCAATGAGCAGGG - Intronic
924110439 1:240693540-240693562 AGTGAGAAACCCAACGAGAAGGG - Intergenic
1067535552 10:47107327-47107349 ATGGAGAAGCCCAACCAGGGAGG + Intergenic
1067824837 10:49563316-49563338 ATAAAGAAGCCCCTTGAGGAGGG - Intergenic
1068183658 10:53556327-53556349 ATTGAGAAGCCTAATTGAGAAGG + Intergenic
1069802392 10:71090177-71090199 ATTGATAAGCCCCAGGAGGATGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1072318761 10:94228558-94228580 AGTGAGAACCCTCATGAGGATGG - Intronic
1074671177 10:115793791-115793813 ATTGATAATCCCAATGAGTGTGG + Intronic
1078915268 11:15772924-15772946 AATGAGGAGCCTAAGGAGGAAGG + Intergenic
1079055921 11:17207060-17207082 ATTGAGGAGGGAAATGAGGAAGG - Intronic
1079067381 11:17307290-17307312 ATAGATAAACCCAAGGAGGATGG - Intronic
1079390721 11:20019687-20019709 ATTGAGAAGCGCAGTTAGGGAGG + Intronic
1079944330 11:26722817-26722839 ATGGAGAAGGCCACTGAAGAAGG - Intronic
1080133213 11:28820638-28820660 ATAGAGAAGCCCACTTAGCAAGG + Intergenic
1082108488 11:48245654-48245676 AATCAGCAGACCAATGAGGAAGG - Exonic
1082211674 11:49510677-49510699 AATAAGAAGTCCAAAGAGGAGGG + Intergenic
1082996396 11:59259110-59259132 AGTGAAAGGGCCAATGAGGAGGG - Intergenic
1083713883 11:64564852-64564874 ATCGAGAACCCCCATGAGGTGGG - Intronic
1084800850 11:71542986-71543008 TTTGAAAGGCCCAATGTGGATGG + Intronic
1085614867 11:77989644-77989666 ATTTGGAAGCCCAAGGAGGGTGG + Intronic
1086278059 11:85155624-85155646 CTTTAGAAGGCCAAGGAGGATGG + Intronic
1089118747 11:116117211-116117233 ATTGAGGAGCCCAATGGTCATGG - Intergenic
1090650154 11:128799315-128799337 ATTACCAAGCCCATTGAGGAAGG - Intronic
1091021602 11:132104995-132105017 CATGGGAAGCCAAATGAGGAGGG + Intronic
1093854828 12:24088870-24088892 ATTCAGAAGGCCAGTGAAGAAGG - Intergenic
1095636356 12:44438498-44438520 ATTAAGAGGGCCAAGGAGGATGG - Intergenic
1096025607 12:48358528-48358550 ACTGAGATGTCCAATGATGACGG - Intergenic
1097247044 12:57612413-57612435 ATAGAGGAGGCCAGTGAGGAGGG - Intronic
1097946397 12:65373675-65373697 ATTAAGAAACCTAATGAGCATGG + Intronic
1103150226 12:118631702-118631724 ATTCAGAAGGCCTTTGAGGAGGG - Intergenic
1103265898 12:119629815-119629837 GATGAGAAGGCCAATGATGATGG - Exonic
1106713278 13:32360956-32360978 ATTGAGAAGACCAAAGATGGAGG + Intronic
1106794471 13:33190197-33190219 CTTTGGAAGGCCAATGAGGAAGG + Intronic
1107199179 13:37693181-37693203 ACTGACAATCCCAATGAGAAAGG - Intronic
1110551611 13:76816804-76816826 ATTGTCAAGCCCACTGAGCAGGG + Intergenic
1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG + Intronic
1113321454 13:109236304-109236326 AATGAGAAGCACAATGACTATGG + Intergenic
1113332757 13:109346358-109346380 ATTGAGAAGTCCTATCAGGCAGG - Intergenic
1117422640 14:55562101-55562123 ATTGAGTAGGCTAAGGAGGAAGG + Intronic
1118345498 14:64937825-64937847 CTTGAGAAGCCCAATGCTGAAGG - Intronic
1120197614 14:81502740-81502762 TTTGAGAAGCTGACTGAGGAAGG - Exonic
1120813817 14:88832076-88832098 AATGAGAGGCCTAATGAGTAGGG - Intronic
1121502089 14:94446120-94446142 ACTGAGCAACCCAATGAGGCAGG + Intronic
1121642629 14:95495929-95495951 CTTGAGAGGCCCACTGGGGAAGG - Intergenic
1121661710 14:95640081-95640103 TTGCAGAAACCCAATGAGGAAGG - Intergenic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1128062960 15:64746867-64746889 GGTGAGAAGCCCAGTGAGGTGGG + Intronic
1128478622 15:68018515-68018537 ATTATCAAGCCCATTGAGGAGGG + Intergenic
1130751392 15:86716813-86716835 ATTGGGAATCCAAATGAGGTGGG + Intronic
1131719045 15:95147212-95147234 CTGGAGAAGCCCAAAGAGTAGGG + Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133273518 16:4623397-4623419 CTTGGGAAGCCAAATGAGTACGG - Intronic
1133382849 16:5345627-5345649 TTTAAGAAGCCCAACGAGCACGG - Intergenic
1133950744 16:10390197-10390219 ATGGAGAAACCCAATGAAGCAGG + Intronic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1135882358 16:26270394-26270416 CTTGACAAACCCAATGAGGCAGG + Intergenic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1142314347 16:89334250-89334272 ATTGTGAAGGCCATTGATGAGGG - Intronic
1146233505 17:31134749-31134771 ATGGAGAAGCCCAAGTAGAAAGG - Intronic
1146484474 17:33231853-33231875 ATTGAGATGAGCAATGGGGAGGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153949883 18:10049509-10049531 ATGGAAAAGCCCATTGGGGAGGG + Intergenic
1155793202 18:29999100-29999122 GTTGAGAAAACCAATGAAGACGG + Intergenic
1156887390 18:42151095-42151117 TTTGCGAAGCCCCATGATGATGG - Intergenic
1157688997 18:49665465-49665487 TCTGAGAAGTCCAAGGAGGAGGG - Intergenic
1158448206 18:57539700-57539722 AGTGACAAGCCCGCTGAGGAGGG - Intergenic
1158597757 18:58831124-58831146 ATGGAGTTGCCCAATTAGGATGG + Intergenic
1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG + Exonic
1162598715 19:11650127-11650149 ATTGAGTAGCCTGAAGAGGAGGG + Intergenic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165723245 19:38094491-38094513 TTTGGGAAGCCAAAGGAGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167204779 19:48093655-48093677 AATGAGAAGACCAGTGAGGCTGG - Intronic
926055509 2:9771686-9771708 TTTGAGAAACCCAGTGAGAAGGG + Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
929093966 2:38246599-38246621 AATGAGAAGCCCATCGATGATGG + Intergenic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
931039580 2:58282550-58282572 ATCTAGAAGCCAAAAGAGGAAGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
934680355 2:96279199-96279221 AGTGAGCAGCCCAAGGAGGAAGG + Intronic
936141914 2:109948048-109948070 GCTGAGCAGCCCAATGAGCAGGG - Intergenic
936178602 2:110245996-110246018 GCTGAGCAGCCCAATGAGCAGGG - Intergenic
936202776 2:110423436-110423458 GCTGAGCAGCCCAATGAGCAGGG + Intronic
936750540 2:115635678-115635700 CTCTAGAAGCCCAATGGGGAGGG + Intronic
937036497 2:118786659-118786681 AGAGAGAAGCCCAGTGGGGACGG - Intergenic
937468822 2:122157921-122157943 ACCAACAAGCCCAATGAGGAAGG - Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939873986 2:147555735-147555757 TTTGAGAAGCCCATTGATTATGG + Intergenic
941238620 2:163009222-163009244 ATTTACAAGCCCAATAAGAAGGG - Intergenic
941775087 2:169384682-169384704 ATTGAGGAGCCAAATGAGTAAGG - Intergenic
942857572 2:180568425-180568447 ACTGAGACGCCCAGTGATGAAGG - Intergenic
947062203 2:226179602-226179624 AATGAGAAGCCTGATAAGGAAGG + Intergenic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
1170081625 20:12482928-12482950 GTTGAGAAGCTTAAAGAGGAAGG + Intergenic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1176049674 20:63111349-63111371 TTTGTGAAGGCCACTGAGGATGG - Intergenic
1177380181 21:20330772-20330794 ACTGAGAAGCCCAAGGCTGAGGG + Intergenic
1178778721 21:35578486-35578508 ATTCAGAAGACAAATGAGGCAGG + Intronic
1180140925 21:45893014-45893036 ACAGGGAAGCCCCATGAGGAGGG + Intronic
1182192511 22:28477442-28477464 ATTGAGAAGGCCAATGTGGCTGG - Intronic
1182673607 22:32018851-32018873 ATTAAGATGCCCAAGGAGGGTGG - Intergenic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
949099684 3:128972-128994 ATTGAGAAGGCCTCAGAGGAAGG - Intergenic
949683678 3:6543906-6543928 ATTAAGAATACCAATGAGGTTGG - Intergenic
950131475 3:10549871-10549893 ACTGAGGGGCCCACTGAGGAGGG + Intronic
950559853 3:13715077-13715099 ATTGAGGGGCCCAAGGTGGAGGG + Intergenic
952337826 3:32420413-32420435 AAAGTGAAGCCCAATGAGGTGGG + Intronic
954807605 3:53229541-53229563 ATTCAGAAGCCCAGAAAGGATGG - Intronic
955382715 3:58452966-58452988 ATTAAGAAACCCACTGAGGCTGG - Intergenic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960096796 3:113696857-113696879 ATCGGGCGGCCCAATGAGGAGGG + Intergenic
961723341 3:128910115-128910137 GTTGCGGAGCCCAATGCGGATGG - Exonic
962377473 3:134870478-134870500 ATTCAGAAGCCCACTTAGAAAGG + Intronic
963221595 3:142818971-142818993 ACTGAGAAGCCATCTGAGGATGG - Intronic
963704217 3:148665620-148665642 AATGAGAAGACCAAGGAGGGAGG - Intergenic
967828441 3:193897766-193897788 GTTGTGAAGGCCAAAGAGGATGG + Intergenic
968602262 4:1515782-1515804 ATGGAGAAGCCCATAGAGGCAGG - Intergenic
971258188 4:25032108-25032130 ATTGACAAGATCCATGAGGACGG + Intergenic
972638679 4:40906548-40906570 TTTCAGAGTCCCAATGAGGAGGG + Intronic
977272987 4:94940998-94941020 ATTGGGAATTTCAATGAGGAAGG + Intronic
977745745 4:100545005-100545027 ATTGAGAAGACCAAAGATAAAGG + Intronic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
981798743 4:148631023-148631045 ATTGAGATGCCCAAAGGAGAAGG + Intergenic
981876868 4:149557471-149557493 TTTGAGAACCCCATTGAGGTTGG - Intergenic
982691926 4:158558216-158558238 AATGAGGACACCAATGAGGAAGG - Intronic
982988289 4:162238386-162238408 CATGAGAAGCCAAATGAGGGAGG - Intergenic
988554169 5:32222004-32222026 ATTGTGAAGAACAATGATGATGG + Intergenic
992154412 5:73940704-73940726 ATGGCCAAGCCCAATGAGAAAGG - Intronic
994805292 5:104439379-104439401 ATTAAGAAAACCAATAAGGAAGG + Intergenic
995614598 5:113946820-113946842 ATTGAGAAGCCAAAGGAGAAAGG - Intergenic
995849316 5:116528387-116528409 ATTGTAAAGGCGAATGAGGATGG - Intronic
995896300 5:117015169-117015191 ATTGAATAGACTAATGAGGAAGG - Intergenic
997669282 5:135657058-135657080 ATTCAGATGCCCATTGAGGAGGG - Intergenic
998371036 5:141661686-141661708 ATAGAGATGCCCAATGAGGGTGG + Exonic
999754655 5:154655358-154655380 TTTTAGAACCCCAATGAGGAAGG + Intergenic
1000592348 5:163173616-163173638 ATAGAGAAGCCTTATGAGGGAGG - Intergenic
1001104759 5:168843707-168843729 TTAGAGAAGCCCAGAGAGGAAGG - Intronic
1003923686 6:10856891-10856913 ATTCATAAGCCCAATGATGCAGG - Intronic
1004589576 6:17036322-17036344 ATTAAGAAACTCAATCAGGAGGG - Intergenic
1005690502 6:28300384-28300406 ATTGAGAAGACCTATGCAGAGGG - Intronic
1006129952 6:31863066-31863088 ATCAAAAAGCCCAATAAGGATGG - Intergenic
1006732819 6:36248954-36248976 CTAGAGAGGCCCAATGGGGAAGG + Intronic
1006807209 6:36796451-36796473 ATGGAGATGCCCTATGAGGGAGG - Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1008189219 6:48433601-48433623 AGTGAGTAGCCCAAAGAGAAAGG + Intergenic
1009630768 6:66197553-66197575 ATAGAGTAGACCTATGAGGATGG - Intergenic
1010289224 6:74116015-74116037 TTTGAGAAGCCTAACAAGGAAGG + Intergenic
1011330284 6:86197307-86197329 AATGAGAATCACAATGAGGGGGG + Intergenic
1012252763 6:96997165-96997187 ATTGAGCAAGCAAATGAGGAAGG + Intronic
1012338899 6:98093807-98093829 ATTGTGAAACCCACTGAGCAAGG + Intergenic
1015421629 6:133017168-133017190 CATCAGAAGCCCAATTAGGAAGG + Intergenic
1015887543 6:137933775-137933797 ATTGAGAAGCCAAAATAGGAAGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017833882 6:158158789-158158811 AATGAGAAGCTCTATGTGGACGG + Intronic
1018468733 6:164078204-164078226 AATCAGAATCCCAAAGAGGAAGG - Intergenic
1018948246 6:168361902-168361924 ATTGAGGGGCCCAGGGAGGATGG + Intergenic
1019255985 7:51449-51471 ATTGAGAACCCTAATAAGTATGG + Intergenic
1022685389 7:32591505-32591527 ACTGTGAAGGCCAGTGAGGAAGG - Intergenic
1033435370 7:141328980-141329002 ATAAAGAAGGCCAATCAGGAAGG - Intronic
1033502238 7:141963535-141963557 ATAGAGATGCACAATGATGATGG - Intronic
1033547748 7:142417093-142417115 AAAGAGAAGCCCAAAGAGCAAGG - Intergenic
1033550496 7:142442778-142442800 AGAGAGAAGCCCAAAGAGCAAGG - Intergenic
1035273676 7:157734706-157734728 ATTTCGAAGCCAAATGAGAATGG - Intronic
1035762794 8:2081628-2081650 ATTGAGAAGAGCACTGGGGAAGG + Intronic
1037950460 8:23015931-23015953 AATGAGAAGCCCAGAGAGGCAGG - Intronic
1038069274 8:23995440-23995462 ATTGAGAAGTGCAGTGGGGAAGG + Intergenic
1038151516 8:24945054-24945076 ATTGACAAACCCATTGGGGAAGG + Intergenic
1040578269 8:48673629-48673651 GATGAGAAACCCAATGTGGATGG - Intergenic
1041154280 8:54968668-54968690 ATTTGGAAGGCCAATGAGGGTGG + Intergenic
1042117643 8:65449557-65449579 ATTATGAAGCCCAAAAAGGAGGG + Intergenic
1043774335 8:84246015-84246037 ATTCAGAAGCCAAAGGAAGATGG + Intronic
1044362538 8:91305022-91305044 ATTCAGAAGCCCTATGAGGTAGG - Intronic
1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG + Intronic
1050265552 9:3885668-3885690 AATGAGAAGCCCCATGTGAATGG + Intronic
1050574035 9:6974016-6974038 ATTGAAAAACCCAAAGAGGCTGG + Intronic
1051925662 9:22321912-22321934 ATAGAGAAGGCCCATCAGGAAGG - Intergenic
1052820382 9:33133835-33133857 ATTGAGATGCCCACTGGGGTAGG - Intronic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1056305191 9:85283468-85283490 ATTCTGAAGCCAAATGAGGGCGG + Intergenic
1056832335 9:89927393-89927415 ATTGAGAACACCAAACAGGAGGG - Intergenic
1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG + Exonic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG + Intergenic
1059647132 9:116278944-116278966 ATTGAGATAGGCAATGAGGAAGG - Intronic
1060880293 9:127113307-127113329 AAAGAGAAGCCCAAGGAGCATGG - Intronic
1061895160 9:133643330-133643352 ATTCGGAAGCCCATGGAGGAGGG + Intronic
1062652532 9:137585598-137585620 CCTGAGAGGCCCAGTGAGGAAGG + Intronic
1186796061 X:13047617-13047639 CTTGAAAAGCCCACTGAGAAGGG - Intergenic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1188059396 X:25582411-25582433 TTTGAGAGGCCCAGTGATGAAGG + Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1191239554 X:58173094-58173116 ATTTTGAAGCCCAATGAGTTAGG + Intergenic
1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG + Intronic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1199561506 X:149168564-149168586 GTTGAGAAGTCCGATGTGGATGG + Intergenic