ID: 1152274142

View in Genome Browser
Species Human (GRCh38)
Location 17:79344491-79344513
Sequence TCTCAATCATTTTCCTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 197}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152274128_1152274142 27 Left 1152274128 17:79344441-79344463 CCCCTACCAGAGCTGCTGCCCTC 0: 1
1: 0
2: 1
3: 25
4: 280
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1152274134_1152274142 3 Left 1152274134 17:79344465-79344487 CCCTCTATCCCCTTCCTCATTGG 0: 1
1: 1
2: 0
3: 28
4: 303
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1152274133_1152274142 8 Left 1152274133 17:79344460-79344482 CCTCTCCCTCTATCCCCTTCCTC 0: 1
1: 6
2: 33
3: 276
4: 2255
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1152274140_1152274142 -7 Left 1152274140 17:79344475-79344497 CCTTCCTCATTGGGCTTCTCAAT 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1152274130_1152274142 25 Left 1152274130 17:79344443-79344465 CCTACCAGAGCTGCTGCCCTCTC 0: 1
1: 0
2: 3
3: 34
4: 282
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1152274127_1152274142 28 Left 1152274127 17:79344440-79344462 CCCCCTACCAGAGCTGCTGCCCT 0: 1
1: 0
2: 0
3: 20
4: 307
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1152274139_1152274142 -6 Left 1152274139 17:79344474-79344496 CCCTTCCTCATTGGGCTTCTCAA 0: 1
1: 0
2: 2
3: 21
4: 246
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1152274136_1152274142 2 Left 1152274136 17:79344466-79344488 CCTCTATCCCCTTCCTCATTGGG 0: 1
1: 0
2: 4
3: 19
4: 241
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1152274129_1152274142 26 Left 1152274129 17:79344442-79344464 CCCTACCAGAGCTGCTGCCCTCT 0: 1
1: 0
2: 2
3: 24
4: 264
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1152274131_1152274142 21 Left 1152274131 17:79344447-79344469 CCAGAGCTGCTGCCCTCTCCCTC 0: 1
1: 0
2: 3
3: 83
4: 662
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1152274132_1152274142 9 Left 1152274132 17:79344459-79344481 CCCTCTCCCTCTATCCCCTTCCT 0: 1
1: 1
2: 26
3: 288
4: 2374
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1152274138_1152274142 -5 Left 1152274138 17:79344473-79344495 CCCCTTCCTCATTGGGCTTCTCA 0: 1
1: 0
2: 2
3: 22
4: 326
Right 1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG 0: 1
1: 0
2: 0
3: 18
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152274142 Original CRISPR TCTCAATCATTTTCCTGCAG AGG Intronic
900163602 1:1236048-1236070 CCTCAATCCTTGGCCTGCAGAGG - Intergenic
900666355 1:3817955-3817977 TCTCAATCAGTCTCCGGCTGCGG + Intronic
900762459 1:4482334-4482356 TCTCAATCATTTGCCACCTGTGG + Intergenic
900789557 1:4670745-4670767 TTTCACTCATTTTCCTGAACAGG - Intronic
903099080 1:21012363-21012385 TTTCAAGCATTTTATTGCAGTGG - Intronic
904003577 1:27351581-27351603 TCCCATTCTTTTGCCTGCAGTGG + Intronic
904731725 1:32597554-32597576 TCTCAATCCATTTCCTTTAGTGG + Intronic
904855160 1:33492319-33492341 GCTACATCACTTTCCTGCAGAGG + Intronic
904899598 1:33846543-33846565 TCTTCATCATTATCCTGCAAAGG - Intronic
908161816 1:61416986-61417008 TCTTAATCTTTTTCCTGCTTTGG - Intronic
908509183 1:64837565-64837587 TCTTAAACACATTCCTGCAGAGG - Intronic
909160197 1:72137437-72137459 TTTCATTCATGTCCCTGCAGAGG - Intronic
909232520 1:73107996-73108018 TATCAAACATTTTTCTGTAGTGG + Intergenic
909244178 1:73256147-73256169 TATAAAACATTTTCCTGCAGTGG - Intergenic
915567918 1:156726835-156726857 TCTAAATCATTTTTCAGCAAAGG - Intronic
918521537 1:185420382-185420404 TCTTAAATATTTTCCTGCACAGG + Intergenic
918980898 1:191557495-191557517 TCTAATTAATTTTCCTTCAGTGG - Intergenic
920126007 1:203694334-203694356 GCTCAATCATTTCCCTCCACAGG - Intronic
922777156 1:228220274-228220296 TCTTCATCTTCTTCCTGCAGAGG + Intronic
1063740254 10:8809865-8809887 TCTTAATTATTTTTCTGCTGAGG - Intergenic
1064912161 10:20414733-20414755 GCTCCATCATGTCCCTGCAGAGG - Intergenic
1069026442 10:63547511-63547533 TCTCACTTCTTTTCCTGGAGTGG + Intronic
1072297771 10:94028020-94028042 TCTCAATCATTTTCCAGTGGAGG + Intronic
1073493421 10:103870741-103870763 TCGAAATCATATTCCTTCAGGGG - Intergenic
1074207947 10:111300795-111300817 TCTCAATTATTTCCCTGTTGAGG + Intergenic
1075355228 10:121766347-121766369 TCTCCCTCATCTTCCTGGAGTGG - Intronic
1075527021 10:123195427-123195449 TCTCAGTGATCTTCCTGCACTGG + Intergenic
1078608653 11:12800243-12800265 ACTCATTCATTCTCCTGCACTGG - Intronic
1078959900 11:16252825-16252847 TCTCAATAATTTCCCTGCTTAGG - Intronic
1079158053 11:17967253-17967275 CCTCAGTCATTGTCCTGCAGGGG + Intronic
1079483671 11:20911210-20911232 GGACAATCATTTTGCTGCAGAGG + Intronic
1080584798 11:33672106-33672128 TCTCCATCCCTTTCCTGTAGGGG - Exonic
1084934655 11:72580418-72580440 TCTGGCTCATTTTCCTGGAGTGG - Intronic
1084994146 11:72958932-72958954 TCTCAATTATTTTCTTGCTTCGG + Intronic
1085968529 11:81558413-81558435 TCTCATTCCTTTTCCTAAAGTGG - Intergenic
1087858297 11:103120794-103120816 TCTCAATGTTTTACCTGCTGTGG - Exonic
1088916425 11:114231346-114231368 TCTCTATCATTCTGCTGCTGGGG + Intronic
1088992090 11:114962489-114962511 TCTCAATCTACTTCTTGCAGAGG + Intergenic
1089153308 11:116381625-116381647 ACTCTATCCTTTTCCTTCAGAGG + Intergenic
1090304436 11:125678592-125678614 GCACATTCATTTTCCTTCAGGGG - Intronic
1095538611 12:43281648-43281670 TCTAAAACATTTTCCTGCGGAGG - Intergenic
1095863901 12:46950374-46950396 TGTCCATCCTTTCCCTGCAGTGG - Intergenic
1096053174 12:48628894-48628916 TCTCCATCTTTTTATTGCAGTGG - Intergenic
1096213427 12:49784401-49784423 TCTCAATGAGGTTCCTGAAGAGG + Intergenic
1099103005 12:78466195-78466217 TCTCCATCATAATCCTACAGGGG + Intergenic
1099889999 12:88579550-88579572 TCTCAATCACTATCATTCAGAGG + Intronic
1101643486 12:106606193-106606215 TCTCACCCATTTGCCTGCACTGG - Intronic
1102264497 12:111471509-111471531 CCACAATTATTTTCCTGAAGTGG - Intronic
1103160254 12:118723046-118723068 TCCCAATTATTTTCCTGCCTTGG + Intergenic
1109179857 13:59200795-59200817 TCTAAATCATTTCCCTGCCAGGG + Intergenic
1109236013 13:59821456-59821478 TCTCATACATATTCCTGTAGTGG + Intronic
1109859685 13:68180418-68180440 TCTCATTCATTATCAGGCAGTGG - Intergenic
1111279817 13:86007046-86007068 TATCAAGAATTTTCCTGAAGTGG - Intergenic
1114672523 14:24419039-24419061 ACTCAATCATTTTTCTGGACAGG - Exonic
1115936234 14:38556351-38556373 TCTGACTCATTTTCTTGTAGAGG + Intergenic
1115944727 14:38646603-38646625 TGTCAATCAGTGTCCTGAAGTGG - Intergenic
1116622217 14:47220716-47220738 TCTAATTGATTTTCCTGGAGTGG + Intronic
1116708273 14:48331598-48331620 TATTAGTCATTCTCCTGCAGGGG + Intergenic
1120063843 14:80016733-80016755 TCTCAATCTTTTTTCTGTATGGG + Intergenic
1124649160 15:31462261-31462283 TTTAAAGCATTTTCCTCCAGGGG + Intergenic
1127711223 15:61600174-61600196 TCTCAAGCATTCTCCAGCAGAGG - Intergenic
1129334811 15:74845473-74845495 TCTCAGTCTTCCTCCTGCAGCGG - Exonic
1131274167 15:90966790-90966812 AGTCAATCATTTTCCTACAGTGG + Exonic
1131867382 15:96725685-96725707 TTTCATTCATTTTCCTACAATGG - Intergenic
1132129886 15:99266153-99266175 TGTCAATCATGTTCCTGAATTGG + Intronic
1132899371 16:2244923-2244945 TCTGAATCATTTACCCGCAAAGG + Intronic
1133432689 16:5752113-5752135 TGCCATTCATTTTCCTGCAAAGG - Intergenic
1133509885 16:6447483-6447505 TTTCAATCATTTTAGTGCACAGG + Intronic
1135488147 16:22884022-22884044 GCTCTATCATTTTTCTGCAATGG + Intronic
1137867166 16:51911514-51911536 TCTCAATCTTTTTCTTGTAATGG + Intergenic
1139168333 16:64598283-64598305 TCTAAATGATTTACCTTCAGTGG + Intergenic
1145364101 17:22239917-22239939 TCTCAATCATTTGACTCCACCGG + Intergenic
1150894842 17:69197458-69197480 TCTCAATCATTATCTTTCACAGG + Intronic
1152274142 17:79344491-79344513 TCTCAATCATTTTCCTGCAGAGG + Intronic
1155183675 18:23369641-23369663 TCTCAATCTCCTTCCTTCAGGGG - Intronic
1155895184 18:31316448-31316470 TCTCAAACATCTTTCTGGAGAGG - Intergenic
1159027762 18:63201669-63201691 TTTCATTCATGTTCCTGCAAAGG - Intronic
1159081946 18:63744950-63744972 GCTGTATCATTTTCCTGAAGGGG + Intergenic
1159214037 18:65366516-65366538 ACTTTATTATTTTCCTGCAGCGG + Intergenic
1159312446 18:66726561-66726583 TTTGATTCATTTACCTGCAGTGG - Intergenic
1159826752 18:73222212-73222234 TCTGAGTCATTTTACTGCACAGG - Intronic
1160675377 19:388435-388457 TCTCACTCATCCTCCTGCCGGGG - Intergenic
1161225699 19:3144371-3144393 ACTCACTAATATTCCTGCAGCGG - Intronic
1161811891 19:6476043-6476065 TGTCACTCATTATCCAGCAGTGG - Intronic
1161915971 19:7228458-7228480 CCTCAATTGTTTTACTGCAGAGG - Intronic
1164069697 19:21755774-21755796 CTTCATTCATGTTCCTGCAGAGG - Intronic
1164573076 19:29387951-29387973 TCTCTGTCACTTTCCTGCATTGG + Intergenic
1164774128 19:30837825-30837847 GCTCCATCATGTTTCTGCAGAGG + Intergenic
1166647231 19:44541140-44541162 TCTCTCTCTCTTTCCTGCAGAGG - Intergenic
925113233 2:1353835-1353857 CCTCAATCAATCTCCTCCAGTGG - Intronic
925206818 2:2014157-2014179 TTTCATTTTTTTTCCTGCAGTGG + Intronic
925668954 2:6291150-6291172 TCACAATCTTTATCCTACAGAGG + Intergenic
929675284 2:43920709-43920731 TCTGAATCTTTATTCTGCAGTGG + Intronic
929748846 2:44689030-44689052 TCTAAAGCATTTTCCTGCCTCGG - Intronic
930876131 2:56219275-56219297 TCTCCATGATTATACTGCAGGGG - Intronic
933178725 2:79205901-79205923 TCTCAATATATTTCCTGCACAGG + Intronic
934081938 2:88476126-88476148 TCTTTAGCATTTTCCTGCTGAGG - Intergenic
935897149 2:107749842-107749864 TATCACTCATTTGCCTGCAAAGG + Intergenic
936679043 2:114749993-114750015 TCTCAATAATTATCCTTTAGTGG + Intronic
937011325 2:118565335-118565357 TCCCCATCATTCTGCTGCAGAGG - Intergenic
938022111 2:127914509-127914531 TCCCAATCTTTTTGCTGCTGGGG + Intergenic
938075962 2:128337201-128337223 TCTCAATGATGTTTGTGCAGTGG - Intergenic
940841378 2:158585670-158585692 TCTCAAACATCCTCCTGAAGTGG - Intronic
945638369 2:212388560-212388582 TCACGAACATTTTCCTCCAGAGG + Intronic
945658022 2:212649418-212649440 TCTCAATCATTTTCCTCATAGGG - Intergenic
946776461 2:223147518-223147540 TATGAATCATTTTACTGCTGTGG - Intronic
1169608743 20:7354338-7354360 TCTAAATTATTTTTCTGAAGAGG + Intergenic
1170775806 20:19373759-19373781 TATCCATCATTTTCCTGGAGTGG + Intronic
1175667394 20:60871969-60871991 TCTAGATCCTTTTCCTGCTGAGG - Intergenic
1184911663 22:47539415-47539437 TCTCAAGCAATGTCCTGCAATGG - Intergenic
949450538 3:4180386-4180408 TTTCATTCATGTTCCTGCAAAGG - Intronic
949650133 3:6148557-6148579 TTTAAATCATTTTCCCCCAGAGG + Intergenic
951106965 3:18755773-18755795 CCTTAATAATTATCCTGCAGAGG + Intergenic
952196438 3:31080574-31080596 TCTCATTCACTTTTCTGCACAGG + Intergenic
953687774 3:45091536-45091558 TCTCCCTCCCTTTCCTGCAGAGG - Exonic
955567206 3:60259981-60260003 TCTCATTCATTTTCATGCTCTGG - Intronic
955857403 3:63287860-63287882 TCTCCACCATTATCATGCAGTGG - Intronic
956066961 3:65406881-65406903 TCACAGTCATTTTCTTTCAGTGG - Intronic
957422929 3:79995077-79995099 TCTCAATGATTTTCAAGCAAAGG + Intergenic
960181016 3:114578028-114578050 TCTCAAGCATATTCATGCTGAGG - Intronic
960804499 3:121570552-121570574 TATGAATCATTTTCCAGCTGAGG + Intergenic
961616482 3:128186817-128186839 TCTGAAACATTTTCCCCCAGCGG + Intronic
962021307 3:131504656-131504678 TGTTAGTCATTTTGCTGCAGTGG + Intergenic
965151876 3:164988036-164988058 TTTCAAGCATGTTCCTGCATAGG + Intronic
969899612 4:10336634-10336656 GCTAGCTCATTTTCCTGCAGAGG - Intergenic
969986664 4:11218345-11218367 TCTAAATCATTCTCCTGGCGGGG + Intergenic
971398661 4:26254784-26254806 TCTCATTCCTTTGCCTCCAGAGG + Intronic
972140530 4:35953625-35953647 GCTCAATCATGTTGCTGCAAAGG + Intronic
974601894 4:64093889-64093911 GCTCAAGCATTTTCCTGGATTGG + Intergenic
977044114 4:92047666-92047688 TCTCATGCCTTTTCCTGCTGTGG - Intergenic
977380049 4:96261432-96261454 TCTCAATCACTTGCCTGCTGTGG + Intergenic
978989473 4:115061465-115061487 CTTCATTCATTTTCCTGCAAAGG - Intronic
982343102 4:154325372-154325394 TCACAATCATTGTCCTTCACAGG + Intronic
982737038 4:159017758-159017780 TCTGAATCACTTTCCTGCACTGG - Intronic
982737233 4:159019226-159019248 TCTGAATCACTTTCCTGCACTGG - Intronic
983547390 4:168978525-168978547 TATTCACCATTTTCCTGCAGGGG - Intronic
984949032 4:184993068-184993090 TTTAAATCCTTTTTCTGCAGTGG + Intergenic
985121598 4:186648705-186648727 GCTCGAGCCTTTTCCTGCAGAGG + Intronic
986167816 5:5291138-5291160 TCTCAGTGATTTTCCGGCATTGG - Intronic
986590113 5:9359750-9359772 TCTCAAATATTTCCTTGCAGAGG + Intronic
987271319 5:16312463-16312485 CCTCAATAATTTTCCTTCTGAGG - Intergenic
988151985 5:27395209-27395231 TTTCTTTTATTTTCCTGCAGTGG - Intergenic
989253457 5:39342012-39342034 TCATAATCATTTTTCTGGAGAGG + Intronic
989314281 5:40059349-40059371 CCTCAACCATATTCCTTCAGTGG + Intergenic
992115158 5:73532491-73532513 TCTCAATCAATTTAGAGCAGGGG - Intergenic
993441842 5:87966578-87966600 TCTTAATCATTATCCTCCAAAGG + Intergenic
994812235 5:104535006-104535028 TGTCAATCCTTTACCCGCAGTGG + Intergenic
995138582 5:108707039-108707061 TCTCAATCATCTATCTCCAGAGG - Intergenic
996883346 5:128326417-128326439 CCTCTCTCATGTTCCTGCAGGGG + Intronic
1001115872 5:168939013-168939035 TCCATATCATTGTCCTGCAGTGG - Intronic
1001167230 5:169380737-169380759 CCTCATTCATGTTCCTGCAGAGG - Intergenic
1003776954 6:9377702-9377724 TCTCATTTATTTTCCTGCCGTGG + Intergenic
1004160257 6:13206241-13206263 TTTCAAACATTTTCCCCCAGTGG - Intronic
1006824015 6:36920745-36920767 TCTGAATCTTTTTCCTGTAATGG + Intronic
1007976839 6:46110334-46110356 TCTCAATCCTTTTACTCCACCGG + Intergenic
1008088054 6:47264832-47264854 CCGCAGTCATTTTCCAGCAGCGG - Intronic
1008186251 6:48394636-48394658 GCTCCATCATGTTCCTGCAAAGG + Intergenic
1008725669 6:54415335-54415357 GCTCCATCATGTTCCTGCAAAGG + Intergenic
1015536109 6:134269122-134269144 TCTCTATAATTTTCCTGTATCGG - Intronic
1015583301 6:134750066-134750088 TATCAATCATTTCACTGCAGAGG - Intergenic
1016720809 6:147295508-147295530 GCTCTATCACTTTCCTTCAGAGG - Intronic
1016804696 6:148201398-148201420 TCTCAAGCTTGTCCCTGCAGTGG + Intergenic
1017449198 6:154538011-154538033 TATAAATCATCTTCCAGCAGGGG + Intergenic
1018491069 6:164293923-164293945 TTTCACTCCTTCTCCTGCAGAGG - Intergenic
1018687834 6:166317585-166317607 TCTCAATCCTTTTACTCCACCGG + Intergenic
1020722273 7:11762051-11762073 TTTCAATCATGTTGCTGCAAAGG + Intronic
1021150468 7:17144718-17144740 TCTCCAGCAGGTTCCTGCAGTGG + Intergenic
1021553141 7:21893253-21893275 TCCCAATCAGTTTTCTCCAGTGG + Intronic
1023762279 7:43476860-43476882 TCTCAATCATTCCTCTCCAGGGG - Intronic
1025136827 7:56422909-56422931 TCTCAATACTTTTCCTTCAGGGG - Intergenic
1026351325 7:69517909-69517931 TCTGAATCATTCACCTGCACTGG - Intergenic
1027947959 7:84775062-84775084 TCTCCATCACTTCCCTGCATAGG - Intergenic
1029621384 7:101691983-101692005 TGTAAATCATTTACCTGCAAAGG + Intergenic
1030361506 7:108599834-108599856 TATCAATCATTTACCTACAAAGG - Intergenic
1032458445 7:132092034-132092056 TCTCCCTCAGCTTCCTGCAGAGG - Intergenic
1034165496 7:149022086-149022108 ACTCAATCTTTTCACTGCAGAGG + Intronic
1035988271 8:4458617-4458639 TCTCATTGATTTTGCTGCTGAGG - Intronic
1037626527 8:20612120-20612142 TTTCAACCATGTTCCTGCAAAGG + Intergenic
1038176157 8:25184013-25184035 TCTAAACAATTTCCCTGCAGAGG + Intergenic
1039657677 8:39427784-39427806 TCTCCATCATTTTCCATCAGTGG - Intergenic
1040775291 8:51035976-51035998 TCTTACTCATGTTCCTTCAGTGG - Intergenic
1041327359 8:56682600-56682622 TCTCAATGTTTTTCCTCCATTGG - Intergenic
1041355844 8:56999304-56999326 TCTCAATGTCTTTCCTGCAGAGG + Intergenic
1042165622 8:65942988-65943010 GCTCAATTATGTTCCTGCAGAGG - Intergenic
1043373261 8:79617738-79617760 ACTCAAACATTTTCCCGCAATGG + Intronic
1043394036 8:79819062-79819084 TCAGAATCAATATCCTGCAGAGG + Intergenic
1046174587 8:110558869-110558891 TCTCATTCATGAACCTGCAGGGG - Intergenic
1046646552 8:116792158-116792180 TCTGAATGACTTGCCTGCAGAGG + Intronic
1047941001 8:129827180-129827202 TCTCCATCTATTTACTGCAGTGG - Intergenic
1048343812 8:133561266-133561288 TGTAAATCCTTTTCTTGCAGAGG - Intronic
1048479422 8:134774496-134774518 TCATAATCATTTTCCTGGTGTGG - Intergenic
1048798824 8:138177190-138177212 TCTGACTCTTTTGCCTGCAGAGG + Intronic
1050094845 9:2053404-2053426 TATCTATCATTTTATTGCAGTGG + Intronic
1051110788 9:13633178-13633200 TCTCATCCATGTTCCTGCAAAGG - Intergenic
1052533040 9:29712234-29712256 TCTGAATCTTTTTCCTGCTGAGG - Intergenic
1056165365 9:83935948-83935970 TTTCAATTATTTTTCTTCAGAGG - Intergenic
1056926705 9:90840381-90840403 ACTCCACCCTTTTCCTGCAGTGG - Intronic
1058163723 9:101596900-101596922 TCTCAATCATTTTCAAACAAAGG - Intronic
1059201280 9:112419429-112419451 TTTCAATCATCTTCCTGCCTTGG + Intronic
1060045230 9:120335081-120335103 TGTCACTCATTTTCCTGAGGTGG - Intergenic
1060122118 9:121002679-121002701 TCTCCATCAGGTTCCTGTAGTGG - Intronic
1060284251 9:122234827-122234849 TATTAATCTTTTTCCAGCAGAGG + Intergenic
1185625147 X:1475991-1476013 GCTCAAGCATCTCCCTGCAGGGG + Intronic
1186281516 X:7998347-7998369 TCTAAATCATTTCCATGTAGAGG + Intergenic
1186316152 X:8373021-8373043 TCTCAATTATTTTAATGCATGGG - Intergenic
1186588620 X:10903935-10903957 TCTGATTCAGTTTCCAGCAGTGG + Intergenic
1186725537 X:12354560-12354582 TCACAAACATTTTCCAGCATCGG + Intronic
1187312406 X:18157990-18158012 TACCAAACATTTTCCCGCAGTGG + Intergenic
1187559127 X:20383364-20383386 TCTCAATGCTTTTCCCACAGGGG + Intergenic
1187724854 X:22191813-22191835 TGTGACTCATCTTCCTGCAGAGG - Intronic
1188113367 X:26217010-26217032 TCTCAATCTTCCTCCTCCAGTGG + Intronic
1195425877 X:104729806-104729828 GCTCCATCATGTTCCTGCAAAGG + Intronic
1196939699 X:120763009-120763031 TCTCAATCTTTTACATGCATTGG + Intergenic
1198785603 X:140284215-140284237 CCTCACTCATCTTCCAGCAGAGG - Intergenic
1199402716 X:147418148-147418170 TCTCCAACTTTTTCCTGCTGAGG - Intergenic
1201497699 Y:14606668-14606690 TCACAATAACTTCCCTGCAGAGG + Intronic