ID: 1152274143

View in Genome Browser
Species Human (GRCh38)
Location 17:79344495-79344517
Sequence AATCATTTTCCTGCAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 240}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152274139_1152274143 -2 Left 1152274139 17:79344474-79344496 CCCTTCCTCATTGGGCTTCTCAA 0: 1
1: 0
2: 2
3: 21
4: 246
Right 1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG 0: 1
1: 0
2: 1
3: 34
4: 240
1152274131_1152274143 25 Left 1152274131 17:79344447-79344469 CCAGAGCTGCTGCCCTCTCCCTC 0: 1
1: 0
2: 3
3: 83
4: 662
Right 1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG 0: 1
1: 0
2: 1
3: 34
4: 240
1152274140_1152274143 -3 Left 1152274140 17:79344475-79344497 CCTTCCTCATTGGGCTTCTCAAT 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG 0: 1
1: 0
2: 1
3: 34
4: 240
1152274129_1152274143 30 Left 1152274129 17:79344442-79344464 CCCTACCAGAGCTGCTGCCCTCT 0: 1
1: 0
2: 2
3: 24
4: 264
Right 1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG 0: 1
1: 0
2: 1
3: 34
4: 240
1152274136_1152274143 6 Left 1152274136 17:79344466-79344488 CCTCTATCCCCTTCCTCATTGGG 0: 1
1: 0
2: 4
3: 19
4: 241
Right 1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG 0: 1
1: 0
2: 1
3: 34
4: 240
1152274130_1152274143 29 Left 1152274130 17:79344443-79344465 CCTACCAGAGCTGCTGCCCTCTC 0: 1
1: 0
2: 3
3: 34
4: 282
Right 1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG 0: 1
1: 0
2: 1
3: 34
4: 240
1152274132_1152274143 13 Left 1152274132 17:79344459-79344481 CCCTCTCCCTCTATCCCCTTCCT 0: 1
1: 1
2: 26
3: 288
4: 2374
Right 1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG 0: 1
1: 0
2: 1
3: 34
4: 240
1152274133_1152274143 12 Left 1152274133 17:79344460-79344482 CCTCTCCCTCTATCCCCTTCCTC 0: 1
1: 6
2: 33
3: 276
4: 2255
Right 1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG 0: 1
1: 0
2: 1
3: 34
4: 240
1152274134_1152274143 7 Left 1152274134 17:79344465-79344487 CCCTCTATCCCCTTCCTCATTGG 0: 1
1: 1
2: 0
3: 28
4: 303
Right 1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG 0: 1
1: 0
2: 1
3: 34
4: 240
1152274138_1152274143 -1 Left 1152274138 17:79344473-79344495 CCCCTTCCTCATTGGGCTTCTCA 0: 1
1: 0
2: 2
3: 22
4: 326
Right 1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG 0: 1
1: 0
2: 1
3: 34
4: 240
1152274141_1152274143 -7 Left 1152274141 17:79344479-79344501 CCTCATTGGGCTTCTCAATCATT 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG 0: 1
1: 0
2: 1
3: 34
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152274143 Original CRISPR AATCATTTTCCTGCAGAGGA TGG Intronic
903528401 1:24010785-24010807 AATCATTTTCCTGGTAAGGGTGG + Intergenic
903686746 1:25137211-25137233 CACCCTCTTCCTGCAGAGGAAGG + Intergenic
904983017 1:34522611-34522633 AATGCTTTTTCAGCAGAGGAAGG - Intergenic
906098873 1:43243214-43243236 AGACATTTTCCTGCAGAAAAGGG - Intronic
906194058 1:43918805-43918827 AATCATATTCCTGGATGGGAAGG - Intronic
906723179 1:48023924-48023946 AACCACTTTCCTGGGGAGGAGGG + Intergenic
908509181 1:64837561-64837583 AAACACATTCCTGCAGAGGGAGG - Intronic
908970512 1:69823003-69823025 AATCATTTTCCTTCAGAAGTTGG + Intronic
909424141 1:75502291-75502313 CCTTGTTTTCCTGCAGAGGAGGG + Intronic
909961165 1:81844577-81844599 ATTCTTTGTCTTGCAGAGGAGGG - Intronic
912463041 1:109849794-109849816 AACGATCTTCCTGCAGAAGATGG - Intergenic
914667580 1:149843589-149843611 ATCCCTTTTCCTGCAGATGATGG + Intronic
915785791 1:158610191-158610213 ATTCATTTCTATGCAGAGGAAGG + Intergenic
916485742 1:165257031-165257053 AATCATATTTCTGCAAAGGAAGG + Intronic
916924907 1:169508379-169508401 AATCATTTTCCTTCAGGCAAAGG - Intergenic
917441420 1:175072299-175072321 AATCATTGTCTTACAGAGGCTGG - Intronic
918650184 1:186952937-186952959 ATTCATTCACCTGCTGAGGAAGG + Intronic
918895933 1:190346142-190346164 AATCATTTTACTACAGTTGATGG - Intronic
919883081 1:201913687-201913709 AACCCTTTTGCTGCTGAGGAAGG + Intronic
920272171 1:204773974-204773996 AATCATTTTCCTGCTGAAAGAGG - Intergenic
920725945 1:208435409-208435431 AATAATCGACCTGCAGAGGATGG + Intergenic
922681762 1:227604355-227604377 AATCATTCTACTGCATAAGAAGG + Intronic
923397425 1:233581004-233581026 ATTCCTTTTCCTACAGTGGATGG - Intergenic
923773557 1:236958786-236958808 AATCATTTTCATGTGGAGAAAGG + Intergenic
924111640 1:240705294-240705316 AAACATTTTCATGCAGGGCATGG - Intergenic
1063293167 10:4772419-4772441 AATCATTTTATTCCAGAGTAAGG + Intergenic
1066620184 10:37340542-37340564 AATCTTTTTCATGCTGAGGTGGG + Intronic
1066622483 10:37372433-37372455 AATCTTTTTCATGCTGAGGTGGG + Intronic
1067247725 10:44560175-44560197 CATTATTTTCCTGCAGAAGAAGG - Intergenic
1069942683 10:71965785-71965807 ATTGATTTTCCAGCAGAGAAGGG + Intronic
1072490200 10:95897949-95897971 AATTATTTTCCTCTAGAGCAGGG + Intronic
1072948536 10:99832563-99832585 AAGGATTATTCTGCAGAGGAAGG + Intronic
1074414536 10:113255673-113255695 AACCTTCTTCCTGCGGAGGAGGG - Intergenic
1074435267 10:113428693-113428715 CATCATTTGCCTGAAGAGGATGG + Intergenic
1076089906 10:127674794-127674816 AATCATTTTTCTTCAGCTGAAGG - Intergenic
1076537089 10:131186612-131186634 ACTGATTCTCCTGCAAAGGATGG + Intronic
1079483673 11:20911214-20911236 AATCATTTTGCTGCAGAGGTGGG + Intronic
1079614208 11:22470530-22470552 AATGACTTTCCTGCAGAAGAAGG + Intergenic
1080635196 11:34117624-34117646 AATCCTTTTCTTGCAGTGGGAGG + Intronic
1083529330 11:63404661-63404683 AATACTTTTCCTTCAGTGGATGG + Intronic
1086760841 11:90628596-90628618 GATCAATTTCCTACAGATGAAGG + Intergenic
1087757496 11:102070120-102070142 CATCATTTTCTTACAGAGGGAGG + Intronic
1088063820 11:105690742-105690764 AGTCATTTTCCTGCCAAGGATGG + Intronic
1090122649 11:124048826-124048848 AATTATTCTCCTGCAAAGGAAGG - Intergenic
1090377898 11:126304260-126304282 AATCATTTTCCTACACGGGAAGG + Exonic
1091626402 12:2124279-2124301 ATTCATTTTGCTGTAGAGAAAGG + Intronic
1092641055 12:10510234-10510256 TACCTTTTACCTGCAGAGGAAGG - Intronic
1094326135 12:29241478-29241500 ATTTTTTTTCCTGCAGAGAAGGG - Intronic
1094573126 12:31659411-31659433 CGTCATTTTCCTCCAGAGGCGGG - Intronic
1095434653 12:42174252-42174274 AATAATTTTGCTGGAGTGGAAGG - Intronic
1096333347 12:50733937-50733959 AAACATTTCCATGCTGAGGAGGG - Intronic
1097004521 12:55906090-55906112 GATCATTTTCCTGAAAATGAAGG - Intronic
1098082852 12:66807908-66807930 GATCATTTTAGTGCAGAAGATGG - Intergenic
1100038693 12:90283952-90283974 AATAATTGTGCTTCAGAGGATGG - Intergenic
1100846917 12:98668743-98668765 AAGCTTTTTCCTGCAGAGAATGG + Intronic
1102415448 12:112758403-112758425 ACTCATTTTCCTCCAGAGGTGGG + Intronic
1103201550 12:119091955-119091977 CATCATTTTACTCCTGAGGAGGG - Intronic
1103426464 12:120839615-120839637 AATCATTTAGCTGCAGAGTTAGG - Intronic
1105307337 13:19178201-19178223 GACCATTGTCCTGCACAGGAGGG - Intronic
1105873808 13:24535819-24535841 ACTCATTTTTCTACAGATGAGGG + Intergenic
1105938108 13:25120547-25120569 ATTCAATGTCCTGCAGGGGAGGG - Intergenic
1109250293 13:60011339-60011361 AATCTTTTTCCTGGGAAGGAAGG + Intronic
1109340891 13:61057070-61057092 AAACATTTTCATGCATATGAAGG - Intergenic
1112173324 13:96995301-96995323 AAATATTTTCCTGGAGAGGCTGG - Intergenic
1112734783 13:102403492-102403514 ATTCATTTACCTACAGAGAATGG - Intergenic
1112809811 13:103204839-103204861 AATCACTTTCGTGTAGAGAAGGG + Intergenic
1113277627 13:108750345-108750367 AACAATTTTGCTGAAGAGGATGG + Intronic
1114516551 14:23303225-23303247 TTTCATTTTCTTGCAGGGGAAGG + Intronic
1119898065 14:78237762-78237784 AATCATTTACCTGCAAAGTGGGG + Intergenic
1120028439 14:79612390-79612412 GATCACTGTACTGCAGAGGAAGG - Intronic
1120076654 14:80166620-80166642 AATCATTTTCCACCAGAGGGAGG + Intergenic
1120844412 14:89113333-89113355 AGTCATTTTGCTACAGAGGTAGG - Intergenic
1120860356 14:89249769-89249791 AATCCTGTGACTGCAGAGGAGGG + Intronic
1121700166 14:95946902-95946924 AATCATTTTCCTTCAGAGTCTGG + Intergenic
1121799148 14:96758865-96758887 AATCCTTTTCATAGAGAGGAAGG + Intergenic
1121930034 14:97963995-97964017 AATCATTTTGCTGCAGTGAAAGG + Intronic
1122189842 14:100032595-100032617 AATCATTTTTTTGGAGCGGAAGG - Intronic
1123003993 14:105312664-105312686 CATCATTTTCCGACAGAGGAGGG + Exonic
1124781698 15:32642245-32642267 AATCATTCTTCTACTGAGGATGG - Intronic
1126688464 15:51268038-51268060 AATCTTTTTACTGTAGAGGTGGG + Intronic
1126955293 15:53926965-53926987 AAGCATTTTCCTCCAGAAAAAGG + Intergenic
1128019353 15:64376773-64376795 AATCAGATTCCTGAAGAGGCAGG - Exonic
1129965806 15:79734372-79734394 AAAAATTTTCCTGCAGAAGTAGG + Intergenic
1131759884 15:95610864-95610886 AGTCAATTTCCTGCACAGGAAGG - Intergenic
1131760205 15:95614255-95614277 CATCATTTTCCTGGACAGGGAGG + Intergenic
1131822052 15:96283520-96283542 AATCTTTTTCATGCACAGAAAGG + Intergenic
1133264485 16:4575161-4575183 AACCAATTTCCTGCAGAAGAGGG - Exonic
1133574751 16:7078169-7078191 CATCGTTTTCCTGCAGAAGAAGG + Intronic
1137428266 16:48398145-48398167 TATCATGTTCCTACAGGGGATGG + Intronic
1137900162 16:52258945-52258967 AATCATTTTCCTCCAGAATTGGG + Intergenic
1138725927 16:59139220-59139242 AATCATCTGCCTCTAGAGGAGGG - Intergenic
1138839699 16:60484880-60484902 CTTGATTTTCCTGCAGGGGAAGG - Intergenic
1141888664 16:86911198-86911220 TGTCATTTTGCTGCAGAGGAAGG - Intergenic
1142549624 17:730625-730647 AGTCGTTTTCCTGGAGAGAATGG + Intergenic
1143410140 17:6703809-6703831 AAGCATTTGCCAGCAGAGGGAGG + Intronic
1144342712 17:14323403-14323425 AATCATGTATCTTCAGAGGAAGG + Intronic
1144442857 17:15299726-15299748 AATCAAATTCCTGGAGAGGAAGG - Intergenic
1151990644 17:77571876-77571898 AACCATTTTCCTGCAACGGTTGG + Intergenic
1152274143 17:79344495-79344517 AATCATTTTCCTGCAGAGGATGG + Intronic
1153331079 18:3875825-3875847 CCTCATTTTCTAGCAGAGGAAGG + Intronic
1155236434 18:23824442-23824464 GATCATCTTCCTGCCGAGTAAGG + Exonic
1156385871 18:36604434-36604456 AATCATCTGTCTGCTGAGGAAGG - Intronic
1156680899 18:39587049-39587071 AAACATTTTCCTCTAGGGGAGGG - Intergenic
1156998520 18:43497232-43497254 AGACATTTGCATGCAGAGGATGG + Intergenic
1157963947 18:52187296-52187318 AAGTATTTTCCTCAAGAGGAGGG - Intergenic
1159417932 18:68177854-68177876 AATTTTTATCCTGCAGATGAAGG + Intergenic
1160622917 18:80183144-80183166 ACTAATTTTCCTGCAGATGACGG - Intronic
1161811890 19:6476039-6476061 ACTCATTATCCAGCAGTGGATGG - Intronic
1163805900 19:19397352-19397374 ACTCATTCTCCTGCTGAGGCAGG - Intronic
1164788290 19:30955143-30955165 AATTATTTTTGTGGAGAGGAGGG - Intergenic
925189043 2:1868422-1868444 AATGATTTTCTAGAAGAGGAAGG + Intronic
925636996 2:5950116-5950138 CCTGATTTTCCTGCAGAAGAAGG - Intergenic
928140671 2:28726175-28726197 AATCATTCTCCATCAAAGGAAGG - Intergenic
930320237 2:49844791-49844813 AATCATTTTCTTGCCTTGGATGG - Intergenic
931563706 2:63591112-63591134 AATGACTTTCCTGCAGATGCAGG - Intronic
931839890 2:66137091-66137113 AATCATTTGGCTGCAGTAGAAGG + Intergenic
932946500 2:76238687-76238709 AATCTATTTGCTGCAGAGGCTGG + Intergenic
933877574 2:86633869-86633891 AATAATTTGGTTGCAGAGGACGG - Intronic
933974957 2:87501943-87501965 AATCATCTTGCTGGAGAGAACGG + Intergenic
936318869 2:111448870-111448892 AATCATCTTGCTGGAGAGAACGG - Intergenic
936463778 2:112729494-112729516 AACGATGTTGCTGCAGAGGAAGG - Intronic
937527746 2:122791351-122791373 CATCATTTTCTTGCAAAGCAAGG + Intergenic
939900142 2:147841732-147841754 AGTCATCTTCCTGAAGATGAAGG + Intergenic
941470786 2:165884446-165884468 AATAATTTACCTGCAGATGATGG + Intronic
941485166 2:166071434-166071456 ATTCATTTTACAGTAGAGGAAGG - Intronic
945100662 2:206259687-206259709 AAAGATTTTCCTGCAGAAAATGG - Intergenic
945608266 2:211964224-211964246 ATTCATTCTCCAGAAGAGGAGGG - Intronic
946844655 2:223848610-223848632 AAGCCTTTTCCTGAAGAGGGAGG - Intergenic
947094765 2:226553412-226553434 AAACATTTTTCAGAAGAGGAGGG + Intergenic
948284352 2:236772282-236772304 GAACATTTTCCTGCAAAGGGTGG + Intergenic
1170392838 20:15894052-15894074 CATCATGTTCCTGCTGAGGCCGG - Intronic
1170482226 20:16777393-16777415 ACACATTTTCCTGCAGAGCCTGG - Intergenic
1170775809 20:19373763-19373785 CATCATTTTCCTGGAGTGGGTGG + Intronic
1171069966 20:22059021-22059043 ATTCCTTTTCCTGCATAGCATGG + Intergenic
1171124919 20:22593849-22593871 AACTATTTTCCTGCAGGGGAGGG - Intergenic
1173174689 20:40755399-40755421 AATGATTTTTAGGCAGAGGAGGG - Intergenic
1177027704 21:15940730-15940752 AAACCTTTTACTGCATAGGAAGG - Intergenic
1177371869 21:20215066-20215088 AATCAATTTTCTGCACAAGAGGG + Intergenic
1177772850 21:25536221-25536243 AATAATTTTCCTTCAGGGAAGGG - Intergenic
1179168719 21:38956143-38956165 ATGGATTTGCCTGCAGAGGAGGG + Intergenic
1180669228 22:17540465-17540487 AAACATTTTCCTGGAGAAGATGG + Exonic
1181476082 22:23168617-23168639 CATCAGTTTCCTTCAGGGGAAGG - Intergenic
1182444949 22:30384562-30384584 TATCCTTTTCCTGCAGAGCTGGG - Intronic
949562296 3:5213999-5214021 AATCATTTACCAGCAGCAGAAGG + Intronic
950414183 3:12859015-12859037 ACTCATCTTTCTGCAGAGCAAGG - Intronic
950692357 3:14670016-14670038 AGTCATTGTCCAGGAGAGGAAGG + Exonic
950869773 3:16218754-16218776 AATGATTTTTCTGCAGAAGCTGG - Intronic
951106967 3:18755777-18755799 AATAATTATCCTGCAGAGGGTGG + Intergenic
951172840 3:19562354-19562376 ATCAATTTTCCTGTAGAGGAAGG - Intergenic
951698510 3:25470494-25470516 AAGCATTTTCCAGATGAGGAAGG + Intronic
952565477 3:34652389-34652411 AAACATTTCCCTTCAGGGGAAGG - Intergenic
952899632 3:38101165-38101187 ATTCATTTTCCTGCTGGGCATGG + Intronic
952915122 3:38232018-38232040 AATCATTTGAATGCAGAAGAGGG + Intronic
953687771 3:45091532-45091554 CCTCCCTTTCCTGCAGAGGAAGG - Exonic
956935220 3:74093172-74093194 AATCATTTTCCAGAAGTAGATGG - Intergenic
957707817 3:83813128-83813150 CAGCACTTTCCTGCAGAGGTAGG + Intergenic
957728278 3:84096743-84096765 AACCATTTTACTGCAGAAAATGG + Intergenic
959945679 3:112123322-112123344 AACCCTTTCCCTGCAGAGCATGG - Exonic
960377141 3:116916990-116917012 GATCATTATCTTGCAGAGGCTGG + Intronic
967001142 3:185336178-185336200 ATTTATTTTCCTGAACAGGATGG - Intronic
967898307 3:194419056-194419078 AATTATTTACCAACAGAGGATGG + Intronic
968361063 3:198147261-198147283 AATAATTTCCCTGCAGTTGAGGG + Intergenic
968858271 4:3145648-3145670 AATGATTTTCCTCCAGTAGATGG + Intronic
969418031 4:7073840-7073862 AATTCTGTTCCTGCAGATGAAGG + Intergenic
970503878 4:16706965-16706987 AATCATTTGCCTGGAGAGATCGG - Intronic
971752149 4:30663934-30663956 TATTATTTTCCTGTAAAGGAAGG - Intergenic
974079492 4:57197452-57197474 TAGCATTTTCCTACAGATGAAGG - Intergenic
974801246 4:66821797-66821819 AATTATTTTCCTTCTGATGAAGG - Intergenic
975046236 4:69807794-69807816 AATAAGTTTGCTGCAGGGGAAGG + Intergenic
976237288 4:82911704-82911726 ACTCATTTTCCTGCTGAGTGTGG - Intronic
977498481 4:97806586-97806608 CATAATTTCCCAGCAGAGGATGG - Intronic
977570904 4:98628533-98628555 AACCATTTTCCAGGAGAGGCTGG - Intronic
978009640 4:103663794-103663816 AATAATTTGCGTGGAGAGGATGG + Intronic
979585599 4:122412251-122412273 AAAAATTTTCATACAGAGGAAGG + Intronic
981090915 4:140731196-140731218 CATCATTGTGCTGCAGAGGATGG - Intronic
982230529 4:153204666-153204688 AATTTTTTCCCTGCAGAAGAGGG + Intronic
984474420 4:180217556-180217578 AATCTTTTTCATGGAGAGTATGG + Intergenic
987398869 5:17454007-17454029 AATGCTTTTGCTGCAAAGGAGGG - Intergenic
987766647 5:22240489-22240511 AATCATTTTTGGGAAGAGGACGG + Intronic
989528963 5:42484425-42484447 AAGCATTTTCCAGAAGAGGGAGG + Intronic
992093166 5:73337761-73337783 CATCATTTTACAGCACAGGAGGG - Intergenic
992995602 5:82329462-82329484 ATTCATTTTCCTCCAATGGAAGG - Intronic
993434217 5:87871612-87871634 AATCAGTTTCCTTCAGACTATGG - Intergenic
995504660 5:112847488-112847510 AATGAATCTCTTGCAGAGGATGG + Intronic
995590236 5:113692376-113692398 TAGCATTTTTCTTCAGAGGAGGG + Intergenic
995768060 5:115640266-115640288 AAGCATTTTCCTAAAGAGGATGG - Intergenic
995966214 5:117910754-117910776 ACTGGTTTTCCTGCAGAGGCTGG - Intergenic
996633793 5:125666744-125666766 AATCTTCTTTCTGAAGAGGATGG + Intergenic
996752447 5:126902558-126902580 AATCCTTTACCAGCAGTGGATGG + Intronic
996769401 5:127070251-127070273 AATCATTTTTCTTCACTGGATGG + Intronic
997689250 5:135814584-135814606 CATGCTTTTCCTGCAGAGTAGGG + Intergenic
998257461 5:140599271-140599293 AATCACTTTCCTGGATTGGAAGG - Intergenic
999609024 5:153349588-153349610 AATCACATACCTGAAGAGGAAGG + Intergenic
1000555366 5:162718816-162718838 AATCCTCTTTCTGAAGAGGATGG - Intergenic
1002826762 6:781246-781268 AAACCTCTTCCTGCAGAGTATGG + Intergenic
1004392443 6:15220989-15221011 AATCTTTTCCCTGGGGAGGATGG + Intergenic
1006239789 6:32667389-32667411 AATCATTTACCAGCAGGGGTGGG - Intronic
1008107332 6:47453433-47453455 TATCATTTTCTTCCTGAGGATGG + Intergenic
1009306399 6:62095359-62095381 AATTATATACCTGCATAGGACGG - Intronic
1010315187 6:74440114-74440136 AAAAATTTTTCTGGAGAGGAAGG - Intergenic
1010976455 6:82320176-82320198 AATCTTTTTTCTGCACAGGAAGG + Intergenic
1012148682 6:95718459-95718481 AAGAAGTTTGCTGCAGAGGAGGG - Intergenic
1012473164 6:99592699-99592721 AATTATATTCATTCAGAGGAGGG + Intergenic
1012811395 6:103963854-103963876 AATCATTTTGCTGCAGATCTGGG + Intergenic
1013075863 6:106771091-106771113 TATCCATTTCCTGCAGTGGACGG - Intergenic
1013158044 6:107512574-107512596 CATCAATTTTCTGCAGAGGTAGG + Intronic
1013355145 6:109339853-109339875 AACCACTTCCCTGGAGAGGAAGG - Intergenic
1014688521 6:124532936-124532958 TATCTTTTTCCTGAAGAGTAAGG - Intronic
1016068167 6:139705401-139705423 AATCATTTTCAGGCAGAAGTAGG + Intergenic
1016256991 6:142119172-142119194 AAACATTTCCCTGCAATGGAGGG + Intergenic
1017234184 6:152102293-152102315 AATCAGTGTCATGCAGGGGAAGG - Exonic
1017526220 6:155243365-155243387 ACTCACTTCCCTGCAGAGGAAGG - Intronic
1018626321 6:165782248-165782270 AATCAAATTCCTGAGGAGGATGG - Intronic
1019258946 7:69393-69415 AATAATTTCCCTGCAGTTGAGGG - Intergenic
1019313228 7:372869-372891 AGAAGTTTTCCTGCAGAGGAGGG - Intergenic
1019521440 7:1462266-1462288 AATCACTTTGTTGGAGAGGAAGG + Intergenic
1021193548 7:17649527-17649549 AAAAATTATCCTGCAGAAGAGGG - Intergenic
1022461170 7:30608731-30608753 CATCATATTCCTGCATAGCAAGG + Intronic
1022882643 7:34604508-34604530 AATCATGATTCTGCAGTGGAAGG + Intergenic
1023048144 7:36229214-36229236 TCTCTTTTTCTTGCAGAGGAGGG + Intronic
1023053379 7:36272722-36272744 AATTCTTATCATGCAGAGGAAGG - Intronic
1023951725 7:44851286-44851308 AATGATTTTCCTGTTAAGGAAGG - Intergenic
1027914690 7:84301063-84301085 GATGTTTTTCCTGCAGGGGAGGG + Intronic
1028503695 7:91547982-91548004 AAACATCATCCTGCAAAGGAGGG - Intergenic
1028802052 7:94977519-94977541 AGTCATTTTCATGGAGAGGTGGG + Intronic
1029007753 7:97228468-97228490 AATAATTTTCCTAAAGAAGAAGG + Intergenic
1032422202 7:131791459-131791481 ATTGATTTTCCTGCAGATGTTGG - Intergenic
1034165497 7:149022090-149022112 AATCTTTTCACTGCAGAGGATGG + Intronic
1034701966 7:153104396-153104418 AATCATTGGCCAGCAGGGGAGGG - Intergenic
1036053296 8:5224437-5224459 AATGCTTTTCCAGAAGAGGAAGG + Intergenic
1037184277 8:16042622-16042644 AGTCATTTCTCTGCAAAGGAGGG + Intergenic
1037561486 8:20078899-20078921 CATCATGTTCCTGCACAGGAAGG + Intergenic
1038560504 8:28574638-28574660 ATTTATTTTCATGCACAGGAAGG + Intergenic
1041162217 8:55057032-55057054 AAGCATTTTCCTGCAGATATGGG - Intergenic
1041701789 8:60798246-60798268 AAGCTTTGTCCTGTAGAGGAGGG + Intronic
1043297219 8:78681030-78681052 AATCCCTTTCCTGAAGATGAGGG + Intronic
1043394038 8:79819066-79819088 AATCAATATCCTGCAGAGGGTGG + Intergenic
1043807645 8:84692823-84692845 AATCCTTCTACTGGAGAGGAAGG + Intronic
1045697759 8:104829476-104829498 TATATTTTTCCTGCAGAGGTAGG + Intronic
1047728526 8:127705786-127705808 AATCACTTTTCTGCAAAGGCTGG + Intergenic
1047897779 8:129385599-129385621 ACTCATTTTCCTGGATAGGTTGG - Intergenic
1049129716 8:140827512-140827534 CACAAATTTCCTGCAGAGGAGGG + Intronic
1049264226 8:141658739-141658761 AAGCATGCTCCTGCAGAGGTTGG + Intergenic
1049940256 9:538761-538783 AATGATTGTCCCTCAGAGGATGG + Intronic
1049985250 9:944459-944481 AATCATTTTCTCTCAAAGGAGGG - Intronic
1050146842 9:2577434-2577456 AATCACTTTCATGCTGAAGATGG + Intergenic
1051689001 9:19689492-19689514 ATTCATTTTCCTACAGAGTACGG + Intronic
1051792361 9:20820466-20820488 AATTATTTTCCTTCAGTGAAAGG - Intronic
1051861153 9:21626596-21626618 AATCATTTTCCTTCATAGACTGG - Intergenic
1055388521 9:75792304-75792326 TATCATATTCATGCAAAGGAAGG - Intergenic
1057000834 9:91507643-91507665 GATCATTTTCCTCCAGAAAATGG + Intergenic
1057807203 9:98228108-98228130 ACTCCTTTTCCTCTAGAGGAAGG - Intronic
1058744149 9:107973607-107973629 AATCATTTTGCAACAAAGGAAGG + Intergenic
1058981124 9:110171642-110171664 AATGACTTTCCTCCAGGGGACGG - Exonic
1059627907 9:116087539-116087561 AATCATTTGTCTCCAGAGGAAGG - Intergenic
1060531810 9:124351674-124351696 AAGCATTTTCCTCCATGGGAAGG + Exonic
1060893495 9:127202925-127202947 ATTCAGTTACCTGGAGAGGAGGG + Intronic
1061715463 9:132515859-132515881 AATTTTTTTCCTGTAGTGGAAGG - Intronic
1062070777 9:134553992-134554014 ATTCATTTCCCAGCAGGGGATGG + Intergenic
1062745773 9:138211089-138211111 AATAATTTCCCTGCAGTTGAGGG + Intergenic
1186707795 X:12160677-12160699 AATTATCTTCTTTCAGAGGAAGG + Intronic
1187413465 X:19071216-19071238 AATCTTTCTCCTTCAGAAGAGGG + Intronic
1189125072 X:38437315-38437337 ACTCATGTTACTGCAAAGGAGGG + Intronic
1192163200 X:68804034-68804056 AATCATTTTCCAGGTGAGGTGGG - Intergenic
1192230335 X:69260251-69260273 AATCATTGGCGTGCAGAGGCTGG + Intergenic
1192913579 X:75631726-75631748 TATCAATTTTCAGCAGAGGAGGG + Intergenic
1193903839 X:87218447-87218469 CCTCATTTTCCTGCAGGAGAAGG + Intergenic
1196116652 X:112006170-112006192 AATCATCTCCATCCAGAGGATGG + Intronic
1196423648 X:115547568-115547590 TCTCATTTTCCTGCACAGGCTGG + Intergenic
1198143078 X:133825505-133825527 AAGCATTTTCTTGGGGAGGAGGG + Intronic
1199194576 X:145012924-145012946 AAAAATATTTCTGCAGAGGAGGG - Intergenic
1199336704 X:146627055-146627077 ATTCATTTTCCTGTGGTGGAAGG - Intergenic
1199453405 X:147998828-147998850 AATAATTTTCTTTCAGAGTACGG + Intronic
1199591603 X:149472832-149472854 ATTCATCTTCCCCCAGAGGAAGG - Intergenic
1200225386 X:154414088-154414110 AATTCTGCTCCTGCAGAGGAAGG - Exonic
1201288003 Y:12395460-12395482 AGTCATTTTCCTGCAGAGCCAGG + Intergenic