ID: 1152275661

View in Genome Browser
Species Human (GRCh38)
Location 17:79355328-79355350
Sequence TGACTTCTGTTTTCAGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152275656_1152275661 29 Left 1152275656 17:79355276-79355298 CCTGCAGAACGTATCGAGGGCTC 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1152275661 17:79355328-79355350 TGACTTCTGTTTTCAGCCACTGG 0: 1
1: 0
2: 0
3: 23
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152275661 Original CRISPR TGACTTCTGTTTTCAGCCAC TGG Intronic
900679599 1:3909330-3909352 TGACCTTTGTCCTCAGCCACTGG - Intergenic
902034995 1:13451390-13451412 TGATTTCTGTTTTGAGGCTCAGG + Intergenic
905111670 1:35599387-35599409 TAACTTCTGTTTTCTTCCGCTGG - Intergenic
906339897 1:44970345-44970367 TGACTTCTGTTCTCAGACAAAGG - Intronic
907268284 1:53275859-53275881 GGACTCCTGAGTTCAGCCACTGG - Intronic
908312919 1:62903437-62903459 TGTCGTCTGGTTTCAGACACTGG + Intergenic
909726427 1:78841278-78841300 AGACTTCAGTTTTCTGTCACCGG + Intergenic
909897941 1:81097179-81097201 TGACTACTTTATTCAGTCACTGG + Intergenic
911104986 1:94122724-94122746 TGACTACTCTTGGCAGCCACTGG - Intergenic
911383574 1:97146536-97146558 TCTGTTCTGTTTTCAGCCAATGG + Intronic
912435580 1:109658792-109658814 TGACAGCTGTTTTCTGCCTCAGG + Exonic
912437374 1:109671265-109671287 TGACAGCTGTTTTCTGCCTCAGG + Exonic
912439965 1:109690249-109690271 TGACAGCTGTTTTCTGCCTCAGG + Exonic
912443321 1:109714925-109714947 TGACAGCTGTTTTCTGCCTCAGG + Exonic
912476285 1:109937771-109937793 TGACTACTGTTCACAGCCTCTGG + Intergenic
913211624 1:116587564-116587586 TGTCTTATATCTTCAGCCACTGG - Intronic
914408402 1:147400635-147400657 CGCCTGCTGTCTTCAGCCACAGG - Intergenic
915338456 1:155162363-155162385 TCCTTTCTGTTTTCAGCCTCCGG - Intergenic
921330295 1:214028882-214028904 TGATTCCTCTTTTCAGCCTCTGG + Intronic
923527072 1:234780671-234780693 TGTCTTCAGATTTCAGCCATGGG - Intergenic
924546386 1:245031618-245031640 TGACTATTGTGTTAAGCCACTGG + Intronic
924791667 1:247256277-247256299 TCACCTTTGTTTTCAGTCACAGG + Intergenic
1063161705 10:3423311-3423333 TGGCTTCAGTATTCAGCCCCTGG - Intergenic
1063892424 10:10644095-10644117 AGCCTCATGTTTTCAGCCACAGG - Intergenic
1063955868 10:11266312-11266334 TGGGTACTGTTTTTAGCCACCGG - Intronic
1064325168 10:14343673-14343695 AGACTTTTCTTTCCAGCCACAGG + Intronic
1066435628 10:35394822-35394844 TTTCTCCTGCTTTCAGCCACTGG - Intronic
1066596965 10:37061839-37061861 TGACTTCAGTTTCCTGCCTCTGG - Intergenic
1067243464 10:44516594-44516616 GGACGTCTGTTTTCTGTCACCGG - Intergenic
1068428235 10:56895577-56895599 TGCTTTCTGGTTTTAGCCACAGG + Intergenic
1069612866 10:69786844-69786866 TGAGTTGGGTTTTCAGTCACTGG - Intergenic
1070703476 10:78620107-78620129 TCACTTCTCATTTCAGCCCCTGG + Intergenic
1071879399 10:89878693-89878715 TGACTACTCTTCTCAGCCTCTGG + Intergenic
1072863408 10:99030973-99030995 TCACTACTCTTTTCAGCCTCTGG - Intronic
1074757448 10:116635021-116635043 TTTCTTCTGTTCTAAGCCACAGG - Intronic
1076501248 10:130937918-130937940 TGACTTTTCTTCTCAGCCTCTGG - Intergenic
1076567887 10:131411477-131411499 TGACTTCTGTTGACTGTCACTGG + Intergenic
1078184059 11:9036671-9036693 GGACATCTGTTTTCTGCCAGAGG - Intronic
1078588000 11:12610578-12610600 TGTCTTTTGTGTTCAGCTACCGG - Intergenic
1079278024 11:19059853-19059875 TGACTTTTTTTTTCAGCCAAAGG + Intronic
1080287318 11:30630292-30630314 GGACTACTGTATTCAGCTACAGG - Intergenic
1081064411 11:38523024-38523046 TAACTTCTATTTTCAGCCAAGGG + Intergenic
1083471252 11:62885547-62885569 GGACCCCTGTTTTCAGCTACGGG + Exonic
1084535709 11:69755334-69755356 TGACCTCTGTTTTCTGACTCAGG + Intergenic
1085060588 11:73442523-73442545 TGATTTCTTTTTTGACCCACTGG + Intronic
1085079646 11:73623682-73623704 TGGCTGCTGTTATCAGCCACTGG + Intergenic
1085824774 11:79833446-79833468 AGACTTTTGTTTTCAGTCTCAGG - Intergenic
1086404006 11:86484739-86484761 TCCCTTCTCTTTTCATCCACAGG + Intronic
1086919407 11:92569138-92569160 TGACACCTGGTCTCAGCCACTGG - Intronic
1087413973 11:97828807-97828829 TGACTTCTTCTTTGACCCACTGG + Intergenic
1087520204 11:99223700-99223722 TGATTACTGTTTTCAGACAATGG - Intronic
1089718825 11:120392530-120392552 TGACTTGTGTTTTCCGTTACAGG - Intronic
1089884596 11:121807464-121807486 TGATCATTGTTTTCAGCCACAGG + Intergenic
1090483038 11:127084754-127084776 TTAGCTCTGTGTTCAGCCACTGG + Intergenic
1091305521 11:134533435-134533457 TGACTTCTGGTGCCAGCCCCAGG + Intergenic
1091855289 12:3734373-3734395 TGACTTCAGTTTTGAGTCCCGGG - Intronic
1092125657 12:6073506-6073528 AGGCTTCTGATTTCAGCAACGGG + Intronic
1092930685 12:13312649-13312671 TGACTCTTGTTTTAAGCCACTGG - Intergenic
1094392754 12:29970523-29970545 TCACTTCTCCTTTCTGCCACTGG + Intergenic
1095843870 12:46724626-46724648 TTACTTCTCTCTTCAGCCCCAGG + Intergenic
1096938557 12:55312985-55313007 TGATTTATGTTTATAGCCACTGG - Intergenic
1099342317 12:81452806-81452828 TCACTTTTGTTTTGAGCCAAAGG - Intronic
1100250592 12:92818375-92818397 AGACTACTGTTTTCAGACATTGG - Intronic
1100815652 12:98384796-98384818 AGAATTCTGCTTTCAGCGACTGG - Intergenic
1101925527 12:108968335-108968357 TGACTAGTGTTGTCTGCCACAGG - Intronic
1103878804 12:124150096-124150118 TGACTTCTCTTTTCAGACCCAGG + Intronic
1104673082 12:130693738-130693760 TGACTTCTGCTTACACTCACTGG - Intronic
1104930395 12:132336499-132336521 TTGCTGTTGTTTTCAGCCACTGG - Intergenic
1105742430 13:23341558-23341580 TGATTTCTGTTTTCATCAAATGG + Exonic
1105852897 13:24351403-24351425 TGACTTTTGTTTTTAGAGACTGG + Intergenic
1106553312 13:30789704-30789726 TGCCTTCTGGCTTCACCCACAGG - Intergenic
1106611552 13:31287533-31287555 TGAGTTTTGTTCTCAGACACAGG - Intronic
1107638054 13:42413198-42413220 TGACCTCAGTTTTCAACCATAGG - Intergenic
1109492660 13:63123038-63123060 AGACTTTTTTTTTCAGGCACAGG + Intergenic
1109835985 13:67857965-67857987 TGTCTTCTGTGTTCAGGTACTGG - Intergenic
1110430445 13:75417115-75417137 CGTCTTCTGTTCTCTGCCACTGG + Intronic
1110696679 13:78499016-78499038 AGACTTCTGCTTTCATCCAAGGG - Intergenic
1110894280 13:80729582-80729604 TGATTTCAGATTTTAGCCACAGG + Intergenic
1112339682 13:98542978-98543000 TGGCTGCTGTTTTCTGCTACAGG - Intronic
1112930771 13:104733567-104733589 TTACTTCTGTTTTCATCTGCAGG - Intergenic
1113334887 13:109368021-109368043 GCACCTCTGCTTTCAGCCACTGG + Intergenic
1116213841 14:41984613-41984635 TGACTTCAGTTTCCTGCCAGTGG + Intergenic
1118063678 14:62167480-62167502 TGACTTCTTTTTCCATCCATGGG + Intergenic
1119964780 14:78902153-78902175 AGAATTCTGTTTTCTGGCACAGG + Intronic
1120066657 14:80049055-80049077 CGTCTTCTGTTCTCAGACACTGG + Intergenic
1120580323 14:86240060-86240082 TGAATTCTGTTCTCAACCAGTGG - Intergenic
1121939037 14:98050725-98050747 TGATTTCTGTTTTGATCCATGGG - Intergenic
1124402925 15:29366004-29366026 TGACTTCCGTTATCACCTACTGG + Intronic
1125283346 15:38067065-38067087 TGACTTCTCTATCCAACCACAGG - Intergenic
1128507797 15:68289010-68289032 TGACTTCTTTTCTCAGCATCAGG + Intronic
1130399300 15:83534192-83534214 TCCCTTCTGTTTTCTGCCATGGG + Intronic
1133835274 16:9362247-9362269 TGTTTACTGTTTTAAGCCACCGG + Intergenic
1135146016 16:19963460-19963482 TGACTTCAGTTGGCAGCCAAGGG + Intergenic
1135596369 16:23746848-23746870 TGACTTCTTCTTTGATCCACTGG - Intergenic
1140623548 16:76765337-76765359 TGGCTTCTGTTCTCTTCCACTGG - Intergenic
1141128168 16:81415980-81416002 TGACTGCAGTCTTCAGCCTCCGG - Intergenic
1141248887 16:82337001-82337023 TGACTTCTGAGTGGAGCCACAGG - Intergenic
1141616199 16:85211090-85211112 TGCCTCCTGTTTGCAGACACTGG + Intergenic
1150156016 17:62853715-62853737 TGACTTCTGTGCTAAGCCAGTGG - Intergenic
1150940489 17:69687983-69688005 TGACTTTTTTCTTCAGCCCCTGG + Intergenic
1152275661 17:79355328-79355350 TGACTTCTGTTTTCAGCCACTGG + Intronic
1153873270 18:9340593-9340615 TAAATGCTGTTTCCAGCCACTGG - Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1155457480 18:26033891-26033913 TTACATCTGTTTTCATCCAAAGG + Intronic
1157266137 18:46224159-46224181 TGCCTTTTGTTTTAAACCACAGG + Intronic
1158562300 18:58525223-58525245 TGAACTTTGTTTTAAGCCACTGG - Intronic
1159935917 18:74367517-74367539 TCACGGCTGTTTTCGGCCACTGG + Intergenic
1161606847 19:5219844-5219866 TGACCTCTGTGGTCAGTCACAGG - Intronic
1164068959 19:21748389-21748411 AGAATTCTGTTCTCTGCCACTGG + Intronic
1164879786 19:31722427-31722449 TGACTTCTGTATTAAGCCAGTGG - Intergenic
1165699536 19:37926780-37926802 TTACTACTGTTTGCAGCCAAAGG - Intronic
1166445247 19:42852943-42852965 TGAGGTCTGTCTGCAGCCACAGG - Intronic
1166452645 19:42915119-42915141 TGAGGTCTGTCTGCAGCCACAGG - Intronic
1166455133 19:42934401-42934423 TGAGGTCTGTCTGCAGCCACAGG - Intronic
1166464927 19:43023686-43023708 TGAGGTCTGTCTGCAGCCACAGG - Intronic
1166482202 19:43183781-43183803 TGAGGTCTGTCTGCAGCCACAGG - Intronic
1166484687 19:43202902-43202924 TGAGGTCTGTCTGCAGCCACAGG - Intronic
1166491807 19:43266782-43266804 TGAGGTCTGTCTGCAGCCACAGG - Intronic
1167025950 19:46918266-46918288 TTACTTATGTTTTCCTCCACTGG + Intergenic
925065095 2:923207-923229 TGACTTCTGGTTTGAGACATGGG - Intergenic
925504378 2:4544416-4544438 TCACATCTGGTTTCAGACACTGG - Intergenic
927223259 2:20735768-20735790 TGACTTCTGTTGACACCCAAGGG + Intronic
928099091 2:28424553-28424575 TGATTTGGGTTTTCAGGCACAGG - Intergenic
929199174 2:39217422-39217444 TGACTTCTGATTTCAGCATCAGG - Intronic
929531284 2:42754617-42754639 TGCCCTCTGTTTGCAGGCACAGG + Exonic
930474070 2:51856615-51856637 TAATTTCTATTTTCAACCACTGG + Intergenic
932064770 2:68543134-68543156 TGATTTCTGTTTTTCCCCACAGG - Intronic
932422947 2:71612150-71612172 AGGCTTCTGTTGACAGCCACTGG - Intronic
932836805 2:75045763-75045785 TGTCTTGTGTTTTCAAACACAGG + Intergenic
933276044 2:80285496-80285518 TGATTTCTGTTTTCTTCCAGGGG + Intronic
933331597 2:80899240-80899262 GGTCTTCTTTTTTCAGGCACAGG + Intergenic
933867386 2:86533925-86533947 TGATTTCTTTTTTCACCCATTGG + Intronic
933983146 2:87569997-87570019 AGATTGCTGTTTTCAACCACTGG - Intergenic
934649628 2:96083536-96083558 TGCCTTCTGTGCTCAGCCAGAGG + Intergenic
934875594 2:97916506-97916528 CCACTTCTCTCTTCAGCCACAGG + Intronic
935101773 2:100002697-100002719 TGAATTCTGTTCCCAGCCACTGG + Intronic
935318857 2:101865372-101865394 TGATTTCTGTTTTATGCCACAGG - Intronic
935422591 2:102885484-102885506 TGACTTCTCACTTCATCCACAGG + Intergenic
935436159 2:103036106-103036128 TGATTTCTGTTTTGACCCATTGG + Intergenic
936310698 2:111380797-111380819 AGATTGCTGTTTTCAACCACTGG + Intergenic
937914283 2:127091369-127091391 TGAGTGCTGTTCTCAGCCACAGG + Intronic
938510014 2:131931488-131931510 TGATTTCTGTTTTAATCTACTGG + Intergenic
939467827 2:142581116-142581138 TGACTCCTCTTTTCATCTACTGG - Intergenic
940238673 2:151539438-151539460 TGCCTTCTCTTTTCTGCCTCGGG + Intronic
941092026 2:161187953-161187975 TGATTTCTTTTTTGACCCACTGG - Intronic
941652789 2:168111471-168111493 ATTCCTCTGTTTTCAGCCACTGG + Intronic
942907344 2:181199848-181199870 TGTCTTCTATTTTCCACCACAGG + Intergenic
943132832 2:183876795-183876817 TGTCCTCTGTTTTCAGCTGCAGG - Intergenic
943158082 2:184210558-184210580 TCATTTATGTTTTCAGCAACAGG - Intergenic
944989545 2:205220219-205220241 TGAGTTCTGTCTTCATCCTCAGG - Intronic
945259086 2:207827710-207827732 TGGCTCCTGTTTCCAGCCATCGG + Intergenic
946607372 2:221420479-221420501 TGTGTTCTGTTTTCTTCCACGGG + Exonic
947329508 2:229013842-229013864 TGAATTGTGTTCCCAGCCACCGG + Intronic
947460523 2:230300026-230300048 TGTCTTTTGTCTTCAGCTACAGG - Intronic
947960956 2:234236888-234236910 AGACTTCTGTGTTCAGCTAACGG + Intergenic
948516247 2:238505518-238505540 TGAGTGTTGTTTTAAGCCACTGG - Intergenic
1170313787 20:15020439-15020461 TGACTTTGGTTTTAAGACACAGG - Intronic
1170842088 20:19932257-19932279 TCACTTCTGCCTTCCGCCACGGG + Intronic
1173150427 20:40562264-40562286 TCAGCTCTGTTGTCAGCCACAGG + Intergenic
1173198642 20:40937742-40937764 TGATCTCTCTTTTCAGCCACAGG - Intergenic
1173718634 20:45233659-45233681 TAATTTCTTTTTTCATCCACTGG + Intergenic
1175661082 20:60813114-60813136 AGACCTCTGGTTCCAGCCACAGG - Intergenic
1175692862 20:61078028-61078050 TGTCTGTTGTTTTCAGCCTCTGG + Intergenic
1177121825 21:17146659-17146681 TGATCTATGTTTTCGGCCACCGG - Intergenic
1177981514 21:27920893-27920915 TGATTTCTGTTTTAATCTACTGG - Intergenic
1183849108 22:40569232-40569254 TGTCTTCTTTTTTCAGAGACAGG - Intronic
949371818 3:3343606-3343628 TGACTTCTGTTATGAGCTCCTGG + Intergenic
949621581 3:5818711-5818733 TCACTTGTGTTTTCAGCCTGGGG + Intergenic
949825579 3:8161761-8161783 TGAGTATTGTTTTAAGCCACTGG - Intergenic
950800157 3:15544232-15544254 TGACTACTGTTGCCAGCCTCTGG + Intergenic
950825437 3:15814309-15814331 TGATATCTGTTTTCTGCTACAGG - Intronic
951033956 3:17912682-17912704 TGATATCTGATTTCAGCCCCAGG + Intronic
951268422 3:20597516-20597538 TGTCTTTTGTCTTCAGCTACTGG + Intergenic
953067435 3:39486944-39486966 TAACTTCTGTTTTTAGAGACAGG + Intronic
953966873 3:47314855-47314877 TGAGTTCTGTATTCAGCTAAGGG - Intronic
955386391 3:58484500-58484522 TGGCTCCTGTCTTCAGCCCCAGG - Intergenic
957213170 3:77287335-77287357 AGACTTCTGAATTCAGCTACAGG + Intronic
957951014 3:87126494-87126516 TGGCTTCAGTTTTCAGTCATAGG - Intergenic
958043843 3:88258527-88258549 TGACTCGTGTTTTAAGCCACAGG + Intergenic
958077418 3:88699736-88699758 TGACTTCTGTTTTAACACATGGG - Intergenic
958571101 3:95883908-95883930 AGCCTTTTGTTTTCTGCCACAGG - Intergenic
959024356 3:101223501-101223523 TTATTTCTGTTTTCAGCAATGGG - Exonic
959429833 3:106239017-106239039 TAAATTCTATTTTAAGCCACAGG - Intergenic
959727513 3:109560891-109560913 TGTCTTTTGTGTTCAGCTACTGG + Intergenic
960205253 3:114889442-114889464 TGACTTTTTTTCTCAGACACTGG + Intronic
960969328 3:123128159-123128181 TAAACCCTGTTTTCAGCCACAGG + Intronic
961149208 3:124622253-124622275 TTTCTTCTGATTTCAGCCATTGG + Intronic
962489455 3:135878373-135878395 TGAATTCTGTTTTCAGTTTCTGG - Intergenic
963975624 3:151476921-151476943 TGTTTTCTGATGTCAGCCACTGG + Intergenic
966364621 3:179171192-179171214 TGAATTCTTTTTTCACCCATGGG - Intronic
966906981 3:184533396-184533418 AGACAACTGTTTTCAGGCACTGG - Intronic
967297886 3:187983334-187983356 TGACATCAGTTTAGAGCCACTGG + Intergenic
967358632 3:188603673-188603695 TAGCTTGTGTTTTCTGCCACAGG + Intronic
969222953 4:5773266-5773288 TCACTGTTGTTTTCAGCCCCTGG - Intronic
970152615 4:13105961-13105983 TCACTTCTGTTTTCTGCCATAGG - Intergenic
970303879 4:14710576-14710598 TCACTTCTGTTTACAGCCAATGG + Intergenic
970740178 4:19228489-19228511 GGACTTTTCTTCTCAGCCACGGG + Intergenic
972564987 4:40261663-40261685 TGCCTTTTGTTCTCAGCCCCCGG + Intergenic
973122036 4:46533334-46533356 AGGCTTGTGTTTTCAGACACTGG + Intergenic
973122639 4:46541715-46541737 AAGCTTCTGTTTTCAGACACTGG - Intergenic
974395478 4:61329388-61329410 TGACTTTTGATTTCAGACAAAGG - Intronic
975936192 4:79583906-79583928 TGAATTTTGTTTTCAGCAATGGG + Intergenic
977174798 4:93807072-93807094 GGACTGCTGCTTTCAGCCACAGG + Intergenic
979506830 4:121508143-121508165 TCACTTATGTTTTCTGTCACTGG + Intergenic
979616187 4:122745533-122745555 TGGCTTCTGATTTCAACCACTGG + Intergenic
981166611 4:141566377-141566399 TCACTTCTGGGTGCAGCCACAGG - Intergenic
981856214 4:149296176-149296198 TGACTTCTTTTTCCAGCCTTTGG + Intergenic
981996061 4:150976952-150976974 TCAATACTGTTTCCAGCCACTGG - Intronic
982838205 4:160150345-160150367 TGACTTCTGTTTTGAACACCAGG + Intergenic
984607427 4:181801405-181801427 TGGCTACTGTTTTCAAGCACCGG + Intergenic
986725034 5:10589072-10589094 TTACTTCTGCTTTAAGCCTCGGG + Intronic
987028909 5:13957265-13957287 TGAGTTATACTTTCAGCCACTGG - Intergenic
987731306 5:21776165-21776187 TGCCCTCAGTTTCCAGCCACAGG - Intronic
988268254 5:28979672-28979694 TGACATCTGTTCTCAGTCATTGG + Intergenic
992159662 5:73988981-73989003 TGACTGTTGTTTTAAGGCACTGG - Intergenic
993238290 5:85344781-85344803 TGACTTCTGTGTAAACCCACAGG - Intergenic
994696833 5:103082418-103082440 TGAGTTCTTTTTTGACCCACTGG + Intergenic
994792973 5:104255759-104255781 TGACTTCTAGTTTCACCCAGTGG + Intergenic
995184216 5:109254634-109254656 TGAATTCTGTTTTATGCCATTGG + Intergenic
995197573 5:109389838-109389860 TGACTTTGTTTTTCATCCACAGG + Intronic
995799395 5:115977514-115977536 AGACTTCTGTTTGCCACCACAGG - Intronic
995985607 5:118167990-118168012 TGTCTTCAGTTTTCAGCCAGGGG + Intergenic
996069632 5:119120192-119120214 TCACTTCTGTTTTCAGGGCCGGG - Intronic
996653694 5:125913850-125913872 AGAATTCAGTTTCCAGCCACTGG + Intergenic
997810942 5:136969152-136969174 TGATTTCTTTTTTCACCTACCGG + Intergenic
998543639 5:143006831-143006853 GGACTTCTCTTTTCACCCATGGG - Intronic
1001551421 5:172604772-172604794 TGCCTTCTGCTTTCAGCCTTGGG + Intergenic
1004077812 6:12361237-12361259 TGGCATCTGTGCTCAGCCACTGG + Intergenic
1010470896 6:76227227-76227249 ATACTTTTGTTGTCAGCCACTGG - Intergenic
1011641158 6:89417694-89417716 GAACTACTGTTTTCAGCAACTGG + Intergenic
1014658081 6:124132330-124132352 TGTCTTTTGTGTTCAGCTACTGG - Intronic
1016204040 6:141451632-141451654 TGATTTCTGCTTTGAGCCACTGG + Intergenic
1017343732 6:153356181-153356203 TAACTTCTGTTGTCTGCCTCTGG - Intergenic
1018664134 6:166118852-166118874 TGTGTTCTGTTTGCAGCCATTGG - Intergenic
1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG + Intergenic
1019102215 6:169640736-169640758 TGACTTCTGAGGTCAGTCACCGG - Intronic
1020705734 7:11541739-11541761 TCATTTCTGTTTTGAGTCACTGG + Intronic
1021304713 7:19018455-19018477 TGATTTCTTTTTTAAGCCATTGG - Intergenic
1021823673 7:24524503-24524525 TGATTTCTTTTTTCATCCATGGG - Intergenic
1022574330 7:31482902-31482924 TGACTTCTGCTGTCATCTACAGG - Intergenic
1023482508 7:40649250-40649272 TGACTTCTGATCTCAAGCACAGG - Intronic
1024018418 7:45341206-45341228 AGACTTCTGTTTTGACCCATGGG - Intergenic
1024996832 7:55278702-55278724 TGTCTGCTGTTTTAAGCCATGGG - Intergenic
1030007719 7:105135030-105135052 GGACCTCTGTTCTCAGCCCCAGG - Intronic
1030979366 7:116167875-116167897 TTTCTTTTGTTTTAAGCCACTGG + Intergenic
1031168376 7:118259779-118259801 TGACTACTGTTTTAAACCTCAGG + Intergenic
1031590691 7:123588811-123588833 TGATTTCTTTTTTGACCCACTGG + Intronic
1032572518 7:133015509-133015531 TGACCTCTGTTTTGTGCTACTGG - Intronic
1033424758 7:141233983-141234005 TAACTTCTGTCTTCAGGCATGGG + Intronic
1033618753 7:143042661-143042683 TGGCTTCTGTGCTCAGCCTCTGG + Intergenic
1038176196 8:25184194-25184216 TGACTTCTGCCTTCACCCCCTGG - Intergenic
1038434228 8:27523454-27523476 TGACTTCCCATTTCAGCCTCTGG + Intronic
1040601473 8:48888788-48888810 TGAGAGCTGTTTTCAGCCATTGG - Intergenic
1040995280 8:53394876-53394898 TTAATTTTGTTTTCAGCCAGTGG - Intergenic
1042967515 8:74371337-74371359 TGATTTCTTCTTTCAGCCATGGG - Intronic
1044348566 8:91135646-91135668 TCTCTTCTGTTTTCTGACACAGG + Exonic
1044391392 8:91656336-91656358 TTTCTTCTGTTCTCAGCCCCTGG - Intergenic
1045265595 8:100616298-100616320 TGACTTCTTTTTTTACACACTGG - Intronic
1045576449 8:103426371-103426393 TGATTTCTGTTTTTAGCCAGAGG + Intronic
1047003635 8:120597325-120597347 AAATTTCTGTTTTAAGCCACTGG + Intronic
1047033714 8:120912316-120912338 TGACTTCTTTTTTAAGAGACAGG + Intergenic
1047084643 8:121503121-121503143 TGACTTCTGTTTTAAGTGACTGG - Intergenic
1047148976 8:122239531-122239553 TGGCTTATGTTTTCTGACACTGG + Intergenic
1048177386 8:132164933-132164955 GGACTTCTGTTTTGTGCCAATGG + Intronic
1048404427 8:134105586-134105608 TGACCACTGTCATCAGCCACTGG + Intergenic
1049333153 8:142065708-142065730 TTTCTGCTGTTTTCAGCCACCGG + Intergenic
1051806254 9:20995962-20995984 TGACTTTTGTTTTAAGGCATGGG + Intergenic
1051997565 9:23236394-23236416 TGTCTTCTCTTTTCAGGTACTGG - Intergenic
1052292777 9:26863284-26863306 TAACTTCACTTTTCTGCCACAGG - Intronic
1052698633 9:31910953-31910975 TCCCCTCTGTTTTCAGACACTGG + Intergenic
1054916159 9:70497037-70497059 CAACTGCTGTTTTCAGCCATGGG + Intergenic
1055361851 9:75500016-75500038 TATCTGCTGTTTTCAGTCACAGG + Intergenic
1055788202 9:79893661-79893683 TGATTTGTTTTTTAAGCCACTGG + Intergenic
1055916578 9:81408246-81408268 TACCTTCTGTCTTCAGCCATGGG + Intergenic
1056387663 9:86112405-86112427 TGACTGTTGTTTGAAGCCACTGG + Intergenic
1056908095 9:90671959-90671981 TGGCTTCTGGTGACAGCCACAGG - Intergenic
1058951919 9:109912034-109912056 TGATATCTGTTTTCAGACAATGG + Intronic
1060314438 9:122496302-122496324 TGACCTTTGTCTTCAGCTACAGG + Intergenic
1060492137 9:124092825-124092847 TGACTTCTGGTAGCAGCCAGGGG - Intergenic
1186017646 X:5215726-5215748 TCACTACTCTTTTCAGCCACTGG - Intergenic
1186372130 X:8958009-8958031 AGATTTCTATTTACAGCCACCGG + Intergenic
1187090737 X:16093823-16093845 TCACTACTGTTCTCAGCCTCTGG + Intergenic
1189241039 X:39524701-39524723 TGGGTTCTGTTTTCTGCAACTGG - Intergenic
1190540493 X:51472974-51472996 TGACTTCTTATTTGACCCACAGG + Intergenic
1195116438 X:101703667-101703689 TCACTTCTCTTTCCAGCCTCTGG - Intergenic
1197722393 X:129754413-129754435 TGAGGTCTGGTTGCAGCCACAGG - Intronic
1198279105 X:135124617-135124639 TGACTTATGTATTTAGACACTGG - Intergenic
1198291852 X:135247903-135247925 TGACTTATGTATTTAGACACTGG + Intergenic
1198637886 X:138719629-138719651 TGCCATCTGTTTTTAGCTACAGG + Intronic
1199340941 X:146676312-146676334 TGACTTCTCTTTTTCCCCACTGG + Intergenic