ID: 1152278399

View in Genome Browser
Species Human (GRCh38)
Location 17:79371413-79371435
Sequence CCCTTTCCTGCTCCCTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 1, 2: 6, 3: 44, 4: 394}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152278388_1152278399 12 Left 1152278388 17:79371378-79371400 CCGTCTTCCTCAGCTGAGTGCCC 0: 1
1: 0
2: 2
3: 31
4: 267
Right 1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG 0: 1
1: 1
2: 6
3: 44
4: 394
1152278391_1152278399 -9 Left 1152278391 17:79371399-79371421 CCATGCTCGCCCTCCCCTTTCCT 0: 1
1: 0
2: 3
3: 87
4: 944
Right 1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG 0: 1
1: 1
2: 6
3: 44
4: 394
1152278389_1152278399 5 Left 1152278389 17:79371385-79371407 CCTCAGCTGAGTGCCCATGCTCG 0: 1
1: 0
2: 3
3: 9
4: 112
Right 1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG 0: 1
1: 1
2: 6
3: 44
4: 394
1152278390_1152278399 -8 Left 1152278390 17:79371398-79371420 CCCATGCTCGCCCTCCCCTTTCC 0: 1
1: 0
2: 24
3: 319
4: 5344
Right 1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG 0: 1
1: 1
2: 6
3: 44
4: 394
1152278386_1152278399 22 Left 1152278386 17:79371368-79371390 CCCAGGGCTTCCGTCTTCCTCAG 0: 1
1: 0
2: 0
3: 23
4: 222
Right 1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG 0: 1
1: 1
2: 6
3: 44
4: 394
1152278387_1152278399 21 Left 1152278387 17:79371369-79371391 CCAGGGCTTCCGTCTTCCTCAGC 0: 1
1: 0
2: 0
3: 28
4: 264
Right 1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG 0: 1
1: 1
2: 6
3: 44
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152278399 Original CRISPR CCCTTTCCTGCTCCCTGTGG GGG Intronic
900250213 1:1665014-1665036 CCCTGCCCTCCTACCTGTGGGGG - Exonic
900336469 1:2166524-2166546 CCCCTCCCTGCTCCCTGTCCTGG - Intronic
901157869 1:7152611-7152633 CCCTCCCCTTCTCCCTGAGGAGG - Intronic
901286813 1:8086886-8086908 CCCTGTCCTCCTCAGTGTGGAGG + Intergenic
901455538 1:9360904-9360926 CCCTGTGCTGCCACCTGTGGGGG + Intronic
901654538 1:10761919-10761941 CCCTTTCCTTCCCCCTTTGCGGG + Intronic
902230772 1:15026101-15026123 CCCTTTCCTTCTCCCTGACCTGG + Intronic
902617128 1:17629945-17629967 CCCTCTCCTGCTCTGTGAGGTGG + Intronic
902735748 1:18399522-18399544 CCCTTCCCTGCTCCCTGCCTTGG - Intergenic
904453560 1:30632477-30632499 CCCTTTGCCTCTCCCTTTGGGGG + Intergenic
904914624 1:33960940-33960962 CCTTTTCCTGATCCCTGTGTGGG + Intronic
905286769 1:36885698-36885720 CCCTGCCCTGGTCCCTGTGGGGG - Intronic
905891447 1:41521003-41521025 GCCTTTCCCACTCCATGTGGAGG + Intronic
907644904 1:56232613-56232635 CTCTTTCTTGTTCCATGTGGTGG + Intergenic
909950693 1:81716711-81716733 CCCTTTTATGCTCCTTTTGGTGG - Intronic
915119169 1:153617765-153617787 CCCGCCCCTGCTCCCTCTGGTGG + Intergenic
915146957 1:153801038-153801060 CCCTTCCCTGCTCTCCTTGGAGG + Intergenic
915367470 1:155324008-155324030 GCCTTTCCTGCTCCGTGGGCCGG + Intronic
915664077 1:157429077-157429099 CCCTTTCCTACATGCTGTGGAGG + Intergenic
915793064 1:158696059-158696081 CCCTTTCCTACTCCCTGAGCTGG - Intergenic
916080055 1:161226675-161226697 CCCTTTCCTGCTCCCATCGCCGG - Intronic
916426409 1:164685432-164685454 CACCTTCATGCTTCCTGTGGTGG + Intronic
916654115 1:166858252-166858274 GCTTTTACTGCTCCCTGTGCTGG - Exonic
916729808 1:167555783-167555805 CCCTTCCCTGCTCCATGTAAGGG + Intergenic
916826932 1:168451231-168451253 TCCTTGCCTGGCCCCTGTGGTGG - Intergenic
916850296 1:168696423-168696445 CTCTTTCCTTCTCCCTGAGCTGG - Exonic
917516028 1:175709175-175709197 CCATCTCTTGCTTCCTGTGGAGG + Intronic
918656680 1:187035500-187035522 CACTTTCCTAATCCCTGTGCTGG + Intergenic
920106020 1:203554262-203554284 CCACTTCCTGCTGGCTGTGGTGG - Intergenic
920201771 1:204263924-204263946 TCCTTCCTTGCTCCCTGTAGCGG + Intronic
920381835 1:205539259-205539281 CCATCTCCTGTTCCCTGAGGTGG - Intergenic
921216868 1:212945169-212945191 CCCTTTCCTGCACCCTCAGAGGG - Intergenic
921709908 1:218363704-218363726 ACCTTTCCTGATCCCCATGGAGG + Intronic
922767380 1:228163078-228163100 GCCTTTCCTGCTGCCTGTGCAGG + Intergenic
922768906 1:228171428-228171450 CACTTTCCAGCTCTCTGTGCCGG - Intronic
923544320 1:234913213-234913235 CCCTTTGCTGCCCTCTGTGGGGG - Intergenic
924260980 1:242231231-242231253 CCTCTTCCTCCTCCCTGTTGAGG + Intronic
924474482 1:244371230-244371252 CCCTTTCCTTCTCACTGGGCAGG - Intronic
924807680 1:247374036-247374058 CCCTTTCCCGCGCCCTCTGGTGG + Intergenic
924941286 1:248813781-248813803 CCCTCACCTGCTCCCTGTTCAGG + Intronic
1062812446 10:477137-477159 CCTTTTCCTTCTTCCTGTGCTGG - Intronic
1063347427 10:5324986-5325008 CCCTTTCCTTCCCCCTTTGATGG + Intergenic
1063689189 10:8268131-8268153 CTCTCTCCTGCTCCCCGTGTCGG + Intergenic
1064140390 10:12785292-12785314 CCCTTTCCTGCTTTGTCTGGAGG + Intronic
1064301845 10:14129937-14129959 CCATTCCCTCTTCCCTGTGGTGG + Intronic
1064348963 10:14559145-14559167 CTCTTCTCTGCTCCCTGTGCTGG - Intronic
1065825015 10:29562818-29562840 CCCACTCCTGCTGCCTCTGGAGG - Intronic
1065952390 10:30664002-30664024 CCCACTCCTGCTGCCTCTGGAGG + Intergenic
1066080923 10:31929279-31929301 CCCTTTCCGTCTCCCTCAGGCGG - Intergenic
1067437463 10:46288170-46288192 CCCTTTCCTGCTCCTCCTGCTGG + Intronic
1068542744 10:58313486-58313508 ACCTTCTCTGCTCCCTGTTGTGG - Intergenic
1068647118 10:59480247-59480269 CTCTTTCTTGCTCCCTGTGAGGG + Intergenic
1070727900 10:78804528-78804550 CACGTGCCTGCTCCCTGGGGAGG - Intergenic
1071281867 10:84110833-84110855 CCCTTTCCCTCTCCTTTTGGGGG - Intergenic
1071486396 10:86105307-86105329 CAGTTTCCTGGTCTCTGTGGTGG - Intronic
1072195669 10:93115717-93115739 ACCTCTCCCGCTCACTGTGGTGG + Intergenic
1073374446 10:103021015-103021037 ACCTTTGCTTCTCCCTATGGTGG + Intronic
1073449708 10:103602221-103602243 ACCTGTCCTGCGCCCTGCGGAGG - Exonic
1074002724 10:109388612-109388634 CCACTTCCTGCTCCTTGTGATGG - Intergenic
1074015404 10:109529206-109529228 TACTTTCCTCCTCCCTGTGTTGG + Intergenic
1075258418 10:120943487-120943509 CCTTTTCCAGCTCCATGTAGAGG - Intergenic
1075911753 10:126131169-126131191 CCCTTCCCTGCTCCCTGCCTCGG + Intronic
1076410467 10:130245324-130245346 CCCTCACCTCCTCCATGTGGAGG + Intergenic
1076502908 10:130950968-130950990 CACTGTCATGCTCGCTGTGGGGG + Intergenic
1076522065 10:131087676-131087698 CCCCCTCATCCTCCCTGTGGGGG + Intergenic
1076691102 10:132224264-132224286 CCCTTCACTGCAACCTGTGGGGG - Intronic
1076839974 10:133041150-133041172 CCCTTTCTTGATCCCTGAGAAGG - Intergenic
1076843374 10:133057351-133057373 CCCTGCCCTCCTCCCTGTGAAGG - Intergenic
1077163181 11:1122795-1122817 CCCCATCCAGCTGCCTGTGGGGG - Intergenic
1077309740 11:1883007-1883029 TCCTGCTCTGCTCCCTGTGGGGG - Intronic
1077572210 11:3349246-3349268 CCCTTTCCTGTGCTCTGTGCTGG - Intronic
1078364164 11:10692942-10692964 CCCTTCCCTGCTCCCTAGAGGGG - Intronic
1078625045 11:12947749-12947771 CCATTTCCTGCTACCTGTTATGG + Intergenic
1079296325 11:19237904-19237926 CCCTTTTCTGATCTCTGTTGCGG + Exonic
1079388783 11:20003109-20003131 ACCTTTCCTGCACCCTGGGAGGG + Intronic
1079539045 11:21550052-21550074 CCCTCTCCTAGTCTCTGTGGAGG - Intronic
1081673597 11:44955455-44955477 CCCTTTCCTGCTTCCTGTGGGGG + Intergenic
1083203748 11:61135070-61135092 CTGTTCCCTGCGCCCTGTGGCGG - Intronic
1083259354 11:61514854-61514876 CTCCTTCCTGGTCCCTGAGGTGG - Intergenic
1084965352 11:72741604-72741626 CCCCCTCCTGCTCCCGCTGGGGG - Intronic
1086846924 11:91761855-91761877 TCCTGTGCTGCTCCCTGAGGAGG - Intergenic
1087150004 11:94850742-94850764 CACCTTCCAGCACCCTGTGGTGG + Intronic
1089284061 11:117394478-117394500 CCCTCACCTGCTCCCTGTGCCGG - Exonic
1089349587 11:117814805-117814827 CCCCCTCCTGCCCCCTGGGGCGG + Intronic
1089752084 11:120659245-120659267 CCCTCTCCTCCTTCCTGAGGTGG - Intronic
1091134277 11:133174200-133174222 CCATTTCCTTCTTCCTGTCGTGG - Intronic
1091239475 11:134042880-134042902 CCCTGTCCTGTTCTCTGTGAAGG - Intergenic
1093999151 12:25675682-25675704 GCCTGCCTTGCTCCCTGTGGTGG + Intergenic
1094526295 12:31233518-31233540 CCCTGTTCTGCTGCCTGAGGTGG - Intergenic
1096086448 12:48868315-48868337 CACTCTCCTACTGCCTGTGGTGG - Intergenic
1097787081 12:63772750-63772772 CGCTTTCCTGCCCTCTCTGGGGG + Intergenic
1098073796 12:66704624-66704646 CTCTTTCCTGCCACCTGTAGGGG - Intronic
1099234560 12:80068298-80068320 CCCTTGCCACCTCCCTGAGGGGG + Intergenic
1100326371 12:93543506-93543528 CCCTCTCCTGCTCTCAGAGGTGG - Intergenic
1102821130 12:115910051-115910073 CCCTTCCCAGCTGCATGTGGTGG - Intergenic
1103242251 12:119423405-119423427 CCATTTCCTGCTCCCACCGGGGG + Intronic
1103427962 12:120854986-120855008 CCCTTCCCTGCCCCTTGTGGAGG - Intronic
1103597127 12:122030691-122030713 CCCATTTCTTCTCCCTGAGGAGG - Exonic
1103629780 12:122250916-122250938 CCCGTTCCTCCTCCCTTTTGGGG + Intronic
1103738046 12:123072922-123072944 TCCTTCCCTGATCCCTGTTGGGG - Intronic
1104021477 12:124994788-124994810 TCCTTTGCTGTTCCCTGGGGAGG + Intronic
1104604882 12:130180592-130180614 ACCTTTCCTGCTCCCAGTTCTGG + Intergenic
1104944468 12:132409501-132409523 GCCTTTGCTGCAGCCTGTGGGGG + Intergenic
1105673838 13:22648694-22648716 CCCTGCTCTGCTCTCTGTGGTGG + Intergenic
1105800739 13:23901221-23901243 CCCTTTCCCGCTTCCTGTGTGGG + Intronic
1105848293 13:24311875-24311897 CCCTTTCCCGCTTCCTGTGGGGG - Intronic
1106160286 13:27195312-27195334 CCCTTTCCTTTACGCTGTGGAGG - Intergenic
1107766799 13:43744176-43744198 GCCATTCCTGTTCTCTGTGGAGG - Intronic
1108056475 13:46490357-46490379 CCCTTCACTGCTGCATGTGGTGG - Intergenic
1109802646 13:67399575-67399597 CCCTTTCCCTCTCCTTTTGGGGG - Intergenic
1110867089 13:80407913-80407935 CCCTTTCCTCCTCACTGGGTGGG - Intergenic
1114277797 14:21163400-21163422 CCCTTTCCTCCTGCCTTTTGTGG - Intergenic
1114500109 14:23162244-23162266 CCCTTTCCTCCTAGCTGTGAAGG - Intronic
1114549935 14:23526804-23526826 CCCTTTCCTGGTACCTTGGGAGG + Intronic
1115418312 14:33162744-33162766 CTCTTTATTGGTCCCTGTGGTGG + Intronic
1117333976 14:54741012-54741034 CCCTTTACCCTTCCCTGTGGAGG + Intronic
1119143405 14:72288451-72288473 TTCTTCCCTGCTACCTGTGGGGG - Intronic
1119482091 14:74964280-74964302 CCCTTTCCTGCTCCCTCTGTGGG - Intergenic
1120402938 14:84055359-84055381 CCCTTTCCTGTTCCTGGAGGTGG + Intergenic
1121104277 14:91270692-91270714 CCATTGCATGCCCCCTGTGGTGG + Intergenic
1121263431 14:92583067-92583089 CCCTTTCCAGTGCCCTGTGATGG - Intronic
1121453094 14:94021904-94021926 CCTGTCCTTGCTCCCTGTGGTGG - Intergenic
1121629440 14:95411815-95411837 CCCTTTCCTGCCCCCTGCCTAGG - Intronic
1121715151 14:96068507-96068529 TCCTTTTCTACTCCCTGTAGAGG - Intronic
1122325944 14:100880756-100880778 GCCTTGCCTGCTCCCTGGGCTGG + Exonic
1124141626 15:27082102-27082124 CCCTTGCCTGCTTCTGGTGGAGG + Intronic
1124338871 15:28876971-28876993 CCCTCTCCTTTTCCCGGTGGGGG + Intergenic
1124531556 15:30512471-30512493 CCTATTCCTGCTGCCTATGGTGG - Intergenic
1124646422 15:31440627-31440649 CGCTGTCCTGCTCCCTGCGTGGG + Intergenic
1124767102 15:32495224-32495246 CCTATTCCTGCTGCCTATGGTGG + Intergenic
1124831573 15:33154219-33154241 CACTTGCCTGCTCCCTGCAGAGG - Exonic
1128443652 15:67737800-67737822 TTCTTTCCTTCTCCCCGTGGTGG - Intronic
1128565003 15:68695296-68695318 CCCCTCCCTGCTTCCTTTGGAGG + Intronic
1128678173 15:69627040-69627062 ACCTTTCCTGCGCTCTGTGCTGG - Intergenic
1128776024 15:70321243-70321265 CCCCTTCCTGGTCCCTGTGATGG - Intergenic
1129174469 15:73830159-73830181 CCCACTCCAGGTCCCTGTGGTGG - Intergenic
1131236886 15:90704440-90704462 ACCTTTCCTGCTGGGTGTGGGGG + Intergenic
1131595284 15:93792201-93792223 CCCTTTCTTGATCCTTGTGGAGG + Intergenic
1132329241 15:101000147-101000169 CCTTTCCCTACTCCCTGTGGTGG + Intronic
1133018612 16:2956070-2956092 CCCCTTCCTGCACCCTGGGGAGG - Intergenic
1133689640 16:8200943-8200965 AACTTTCCTGCTTCCTGTAGTGG + Intergenic
1135920865 16:26647733-26647755 CCCTGTCCTACTCCATGTGCTGG - Intergenic
1136223603 16:28844437-28844459 GCCTTTCCTGCTGCCTGTGGAGG - Exonic
1136491278 16:30609995-30610017 GCCTTTCCTGGTCCCTGCGCAGG + Exonic
1137516453 16:49148735-49148757 CCCTTCCCTGGGCCGTGTGGAGG - Intergenic
1138434179 16:56988160-56988182 CCCTGACCCGCTCCCTGTGCAGG - Intergenic
1138564275 16:57821428-57821450 CCCTGTTCTGGTCTCTGTGGTGG - Intronic
1138991260 16:62393012-62393034 CCCTTCCCTGCTGCCAGGGGTGG - Intergenic
1139163459 16:64538587-64538609 CCCTTTCTGGCTCTCTCTGGAGG + Intergenic
1139952287 16:70678251-70678273 CACCTTCCTGCAGCCTGTGGTGG - Exonic
1140321002 16:73951689-73951711 AGCTTTCCTGCTCCCTGTCTTGG + Intergenic
1141860173 16:86710978-86711000 CCCCTTCCTGCTCCATCTGAAGG - Intergenic
1142170529 16:88619791-88619813 CCCGTTCCCTCTCCCTGTGTTGG + Intronic
1142409914 16:89910763-89910785 TCCTTCCCTGCTCCCTGTGCCGG - Intronic
1142420526 16:89966855-89966877 CTCTGTCCTGCTCCCTGTGGAGG + Exonic
1142696068 17:1634635-1634657 GCCTTGCCTTTTCCCTGTGGAGG + Exonic
1143125842 17:4640530-4640552 CCCTTTTTTCCTCCCTATGGTGG - Intronic
1143187640 17:5020257-5020279 CCTCTTCCTGTTCCCTGGGGCGG - Intronic
1143402636 17:6656292-6656314 CCCTTTTTTCCTCCCTATGGTGG + Intergenic
1143882777 17:10042505-10042527 CCCTTTCCTGAATCCTGTGTGGG + Intronic
1144574114 17:16418176-16418198 CCCTGTCATGGTCCCTGTTGGGG + Intronic
1144956086 17:19019637-19019659 CTCTTCCCTGCTGCCTGTGGGGG + Intronic
1145166216 17:20614902-20614924 ATCTGTCCTGCTGCCTGTGGAGG + Intergenic
1145722146 17:27083249-27083271 GCCTTTCCTGCTGACTGTAGAGG - Intergenic
1146266837 17:31458423-31458445 CCCCTTCCTGCTGCTTTTGGAGG + Intronic
1146539266 17:33680445-33680467 CCCTCTGCTCCTCCCTGGGGAGG - Intronic
1147158665 17:38558535-38558557 CCCTTCGCTGCTGCCTGAGGCGG - Intronic
1147468313 17:40630831-40630853 CCCTTTCCTCCTGCCTTTTGCGG + Exonic
1148767347 17:50046986-50047008 CCTTGGCCTTCTCCCTGTGGAGG - Intergenic
1151033907 17:70775826-70775848 GCCTTGCCTGCTCCCTAGGGAGG - Intergenic
1151210283 17:72539212-72539234 CCCCTTCCTTGTCCCTCTGGAGG - Intergenic
1152012069 17:77724851-77724873 CCCCTCCCTTGTCCCTGTGGGGG + Intergenic
1152078504 17:78172517-78172539 CCCTTCCCTGCTGCCAGGGGTGG - Exonic
1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG + Intronic
1152424158 17:80210005-80210027 CCCCTGCCTGCTCTCTGTGAAGG + Exonic
1152688497 17:81706887-81706909 TTCTTTCCTGCTCCCTAAGGCGG + Exonic
1153510729 18:5848985-5849007 ACCATTTCTGATCCCTGTGGTGG - Intergenic
1153761961 18:8340092-8340114 CCCTGGCCTGGTCACTGTGGTGG - Intronic
1153894258 18:9544266-9544288 CCCTTCCCTGTCCCCTGTGAGGG + Intergenic
1154056293 18:11015638-11015660 CCCTTTCCTGCTGCATTTGCTGG + Intronic
1155346184 18:24859585-24859607 CCCTCTGCTGATCCCTTTGGGGG - Intergenic
1155362596 18:25017061-25017083 GCCTTTCTTGGTCCCTTTGGAGG + Intergenic
1156283967 18:35672427-35672449 TCCATTCCTGCTCCCCGAGGTGG + Intronic
1156585731 18:38428914-38428936 CGCTTTCCTCCTCCCTTTTGAGG - Intergenic
1156922809 18:42543346-42543368 CCCTTTCCTTCTCAGTGTGAAGG + Intergenic
1157389318 18:47288084-47288106 TCCTTTCCAGCTCCTTCTGGCGG + Intergenic
1157443812 18:47729930-47729952 GCCTTTCCTGCTCTCTGTCGGGG + Intergenic
1159632282 18:70762901-70762923 CCCTTTGCCTCGCCCTGTGGCGG + Intergenic
1160281764 18:77497955-77497977 CCCTTTCTTGCTTCCTGGGGAGG + Intergenic
1162284561 19:9728496-9728518 CCCTTTCCCTCTCCTTTTGGGGG + Intergenic
1162532842 19:11245763-11245785 CCCCTTCCTTCTCCTTGTTGGGG - Intronic
1163081885 19:14950156-14950178 CCCTTCCCTCCTCTCTGGGGGGG + Intronic
1163519751 19:17784862-17784884 CCAGATCCTGCTGCCTGTGGGGG + Exonic
1163681394 19:18684361-18684383 CCCATTCTTGCTACCTGAGGGGG + Intronic
1163789253 19:19296957-19296979 CCCTCTCCCCCTCCCTGTGTTGG - Intronic
1163943565 19:20516178-20516200 CCCTTTCCCTCTCCTTTTGGGGG + Intergenic
1164803000 19:31093234-31093256 CCCTCTGCTTCTCCCTGTTGAGG - Intergenic
1165097532 19:33417733-33417755 TCCTCTCCTGCTGCCTGAGGAGG - Intronic
1165213750 19:34254778-34254800 CCCTTGCCCGCCCGCTGTGGAGG + Intronic
1165255313 19:34574127-34574149 CACCTTCCTGTTACCTGTGGAGG + Intergenic
1165530346 19:36394598-36394620 CCCTTTACTGCTCCCTGGAGAGG + Intronic
1166126361 19:40717333-40717355 CCCTCTCAGGCTCGCTGTGGAGG - Exonic
1166937499 19:46343283-46343305 CCCCTCCCTCCTCCCTCTGGAGG + Exonic
925237763 2:2293959-2293981 CCCTGTCCTGCCCCCCGTGCTGG - Intronic
925860799 2:8173291-8173313 GCCTTTCCTGCACCACGTGGTGG - Intergenic
925938401 2:8790274-8790296 CCCTCTCCTGCTTCACGTGGAGG + Intronic
927418469 2:22904293-22904315 CCCTTACCTGCGCCCCCTGGAGG - Intergenic
927806379 2:26150398-26150420 CCCTTTCCTCCTGCCTTTTGCGG - Intergenic
928025567 2:27736098-27736120 ACCTTTCCCCCTCCCTGTTGGGG + Intergenic
928178520 2:29051412-29051434 CTCTTTCCTGTTCCCTGGGCTGG + Intronic
928204834 2:29276447-29276469 CCCTTTCCTGCTCTAAGTGAAGG + Intronic
928205283 2:29279399-29279421 CCCTTCCCTGCAGCCTCTGGGGG - Intronic
929000607 2:37344389-37344411 CCCTTTTCTGTTCCCTGTTTTGG + Intergenic
932333776 2:70917723-70917745 CACTTGGCTGCTCCCTGAGGTGG + Intronic
932558955 2:72850641-72850663 CGCTCTGCTGCTCCCTGAGGTGG + Intergenic
932860004 2:75281169-75281191 CCTTTTCCTCTTCCCTGTGTTGG + Intergenic
933355966 2:81209327-81209349 AACTTTCCTGCTCTCTCTGGTGG - Intergenic
933898463 2:86832664-86832686 CAATTTACTGCTCCCTGTGTGGG + Intronic
934768487 2:96893860-96893882 CCTTTCCCTGCTACCTGTGGTGG + Intronic
934777133 2:96946701-96946723 CCTTGTCCTGCTCCCTGCAGTGG - Intronic
934857989 2:97740808-97740830 CCCATTCCTGTCCCCTGTTGGGG + Intergenic
935133002 2:100275308-100275330 CCGTTCCTTGCTCCTTGTGGAGG - Exonic
935190846 2:100777684-100777706 CCCTTCCCTGGCCCCTGTTGCGG - Intergenic
935535118 2:104284908-104284930 GCCTTTCCTCCTCTCTTTGGAGG - Intergenic
936086820 2:109474870-109474892 CCCTTCCCTGCTGGCTCTGGAGG - Intronic
937214390 2:120302143-120302165 TCCTTTACTGCCCACTGTGGTGG + Intergenic
937247813 2:120504736-120504758 CCCATTGCTGAGCCCTGTGGTGG - Intergenic
938312017 2:130298896-130298918 CCATTTCCTGCCTCTTGTGGTGG + Intergenic
939038629 2:137162444-137162466 CCCTCTCCTGATCCCAGTGGTGG - Intronic
940814625 2:158284519-158284541 CCCTGTCCTCCTCCCTGAGTTGG - Intronic
940859105 2:158753934-158753956 CCCTTTTCTCCTCCCCTTGGTGG + Intergenic
941554863 2:166965029-166965051 CTCTTGCTTTCTCCCTGTGGTGG - Intronic
942046269 2:172101108-172101130 CCGGTTCCTGCTCCCTGGGGAGG + Intronic
943605889 2:189976556-189976578 CCATCTCCTGCCCCCTGAGGTGG + Intronic
944117905 2:196208869-196208891 CCCTTGCCTACACCCTCTGGTGG - Intronic
945100668 2:206259788-206259810 TCCTTTCCTGCTGCCTGTTTTGG + Intergenic
946083068 2:217142835-217142857 CCCTCTTCTGCGCCCTCTGGTGG + Intergenic
946864647 2:224031794-224031816 CTCTTTCCTCCTCACTGAGGAGG + Intronic
946908418 2:224437765-224437787 CCCTCTCCTGCTACCTATGAAGG + Intergenic
948186604 2:236026291-236026313 GCCATCCCTGCTCCCTGTGCTGG + Intronic
948635072 2:239329530-239329552 CCCATTCCTGCTCCGGCTGGGGG + Intronic
948635139 2:239329931-239329953 CCCATTCCTGCTCCGGCTGGGGG - Intronic
1169237667 20:3944521-3944543 CCCTTTCCTTCTCCCTTTCTGGG - Intronic
1169382648 20:5121526-5121548 CCCTTTCCTGTTCCCTTTTAAGG - Intronic
1169942458 20:10951906-10951928 CACTTTCCTGCTCCTGATGGGGG - Intergenic
1170408353 20:16063233-16063255 CCCTCCCCTGCTCCATGTGGAGG - Intergenic
1170528078 20:17260978-17261000 CCATTTTCTACTCCCTGTGATGG + Intronic
1170626842 20:18036673-18036695 CCCTTTCTTGCTTCCTCTGTGGG + Intronic
1171790241 20:29516140-29516162 CCCTTTCCTGCCCCCTCATGTGG - Intergenic
1172670912 20:36633853-36633875 CCCACTGCTTCTCCCTGTGGGGG + Intronic
1173148784 20:40548121-40548143 CATTTTCCTGCAGCCTGTGGAGG - Intergenic
1174337408 20:49872956-49872978 CCCTTTCCTGCTCCCTATGCAGG + Intronic
1175646618 20:60679618-60679640 CCTTTCCCTGCCCTCTGTGGAGG - Intergenic
1176117946 20:63441231-63441253 CCCTTTCTTGCAGCCTTTGGGGG - Intronic
1176122828 20:63461802-63461824 CTCTTCCCTGCTCCCTGGGGTGG - Intronic
1176122915 20:63462074-63462096 CTCTTCCCTGCTCCCTGGGGTGG - Intronic
1176122925 20:63462104-63462126 CTCTTCCCTGCTCCCTGGGGTGG - Intronic
1176417252 21:6483856-6483878 CCCTGCTCTGCTCCTTGTGGGGG - Intergenic
1177229062 21:18295794-18295816 CCCTTTTTTTCACCCTGTGGTGG + Intronic
1178699361 21:34820157-34820179 CCCAGCCCTGCTCCCTGTTGGGG - Intronic
1179138529 21:38701502-38701524 CCCTTTCCTTGTCCATGTGATGG - Intergenic
1179692748 21:43092189-43092211 CCCTGCTCTGCTCCTTGTGGGGG - Intergenic
1179724094 21:43332104-43332126 CCCTGTCCTGCTGTCTGTGGTGG + Intergenic
1179895999 21:44364053-44364075 GCCCTTCCTGCTCCCTGTGAAGG - Intronic
1180155316 21:45974642-45974664 CCATCTCCTCCTCCCTGTGAAGG - Intergenic
1180958602 22:19752103-19752125 CCCTTTGCTGAGACCTGTGGAGG - Intergenic
1181022223 22:20109554-20109576 TCCCTTGCTGCTCCCTGGGGTGG + Intronic
1181440489 22:22933034-22933056 CCCTGTCTTTCTCCATGTGGAGG + Intergenic
1181512392 22:23394750-23394772 CCCCTTCCTGCGCCTTGAGGTGG + Intergenic
1181634274 22:24167108-24167130 CCCTGCCCTGGTCCCTGTGGTGG - Exonic
1181806064 22:25375145-25375167 TCCATCCCTGGTCCCTGTGGGGG + Intronic
1181877502 22:25951248-25951270 CCCTCTCTTCCTCCCTGTGATGG - Intronic
1181958520 22:26605789-26605811 TCCTTTCCAGCCCCCTGTCGTGG - Intronic
1182113268 22:27739519-27739541 CATTTTCCTGCTCCCTTTTGTGG + Intergenic
1182363062 22:29758907-29758929 CCTATTCCTTCTCCCTCTGGAGG + Intronic
1182475262 22:30573681-30573703 CCCTTTCCTTCCCCCTGGTGTGG + Intronic
1183262828 22:36806942-36806964 CCCTCTCCTTCTGCCTCTGGGGG - Intronic
1184624123 22:45709529-45709551 ACATTTCCTGCTTCCTGTGTTGG + Intronic
1184691435 22:46119150-46119172 CCCTTTCTTCCTTCCTCTGGAGG - Intergenic
1184842169 22:47058445-47058467 CTCTTCCCGGCTCCTTGTGGTGG + Intronic
949105276 3:195815-195837 GCTTTTGCTGCTCCCGGTGGTGG + Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951525234 3:23646878-23646900 CCCGATCCTGCTCCCTGTCAGGG - Intergenic
951705732 3:25542503-25542525 CTCTTGATTGCTCCCTGTGGTGG - Intronic
951809862 3:26687082-26687104 CCCTGTCCTGTTCTCAGTGGTGG - Intronic
954370803 3:50168733-50168755 CCCCTTCCTGGATCCTGTGGGGG + Intronic
954638466 3:52084447-52084469 CCCTTGTTTGCTGCCTGTGGTGG - Intronic
955126554 3:56117971-56117993 CCCATTCCCTCTCCCTGGGGTGG - Intronic
955365784 3:58308743-58308765 CAGTTTCCTGTTCCCTGTAGTGG + Intronic
955772935 3:62404743-62404765 ACCCCTCCTGCTCCCTGGGGAGG - Intronic
958712682 3:97737158-97737180 TCCTTTACTGCTTCCTGTGCTGG - Intronic
959497872 3:107072437-107072459 CCCTCTCCTGTTCCCTGAGAAGG - Intergenic
960993547 3:123326690-123326712 CCTCTTCCTGGTGCCTGTGGAGG + Intronic
962320413 3:134385321-134385343 TCCTTTCCTGCTGCCTTTGTGGG - Intergenic
962818117 3:139020612-139020634 GCCTTCCCTGCTCCCTGGTGGGG - Exonic
963229085 3:142891714-142891736 CACTTTTCTACTGCCTGTGGGGG - Intergenic
964522773 3:157585594-157585616 CCCTTTCCCTCTCCTTCTGGGGG + Intronic
966639706 3:182176183-182176205 CCCTTGCATCCTCCCTGTGAAGG - Intergenic
966743671 3:183255146-183255168 ACCTTGCCTGTTCCCTGTGGGGG + Intronic
967493633 3:190120387-190120409 CCCTTTTCCGCTCCTTGTTGGGG - Exonic
968507380 4:977131-977153 CTCTCCCCAGCTCCCTGTGGCGG - Intronic
969203348 4:5622973-5622995 CCCTACGCTGCTCCCTGTGCTGG + Exonic
969285872 4:6201379-6201401 CCCCATGCTGCTCCCTTTGGTGG - Intergenic
969500948 4:7552622-7552644 ACTGTTCCTGATCCCTGTGGGGG - Intronic
969971897 4:11056411-11056433 CTCCTTCCTTCTCCCTGTGCCGG - Intergenic
970381385 4:15511397-15511419 TCCTTTCCTCCTCCTTGTGCAGG - Exonic
971127107 4:23765979-23766001 ACCTTTACTGCCCTCTGTGGTGG - Intronic
971136267 4:23871938-23871960 CCCTTTCCTCTTCCCTCTGGAGG - Intronic
973530740 4:51834741-51834763 CCCTTTCCAGCTTCCTGTCCCGG - Intergenic
976289315 4:83400914-83400936 CTCTTTCCTGCTCTCTCTTGTGG - Intergenic
976975847 4:91165517-91165539 CCATGCCCTGCTCCCAGTGGTGG + Intronic
979999031 4:127467119-127467141 CCCTTTCTCTCTCTCTGTGGTGG - Intergenic
982343234 4:154327193-154327215 CCACTTCCCGCTCCCTGGGGAGG + Intronic
985164795 4:187081966-187081988 CCAGTTCCTGCTCCCTTGGGAGG + Intergenic
985760438 5:1746143-1746165 CCCTTCCCTGCTCCCTGCCTCGG - Intergenic
985827098 5:2200543-2200565 CCCTGTCCTGCTCCGTGAGCTGG - Intergenic
985844072 5:2331097-2331119 CCCATTCCTCCTCTCTTTGGAGG + Intergenic
985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG + Intergenic
986439888 5:7771292-7771314 CCTTTTCCTGTTCTCTGTCGTGG + Intronic
986681294 5:10235179-10235201 CACTTTCCTGCTCTCTGTTTGGG - Intronic
987261172 5:16205154-16205176 CTCATTCCTGCTCCCTGGGATGG - Intergenic
990374018 5:55151384-55151406 CCCTTTCTTGGTACCTGTGAGGG - Intronic
993386629 5:87268871-87268893 CCCTTACCTGCCCCCTTTGGGGG + Exonic
998052005 5:139043608-139043630 CCTTTCCCTCCTCCCTTTGGAGG - Intronic
998376141 5:141692201-141692223 CCCTTTCCTGCCCGCTCTGGCGG - Intergenic
998398415 5:141834711-141834733 TCCTTTCCTCCTCCCTGAGAAGG + Intergenic
998797407 5:145834993-145835015 CCTTTTCCCGCTCCCTGTAAAGG + Intronic
999391849 5:151199069-151199091 CCCTTTCCTTCTCCACCTGGGGG + Exonic
999641583 5:153678459-153678481 CCCTCCCCTGGTCCCTGTGCAGG + Intronic
1002634132 5:180598767-180598789 CCCCTTCCTGGGCCCAGTGGGGG - Intergenic
1002721178 5:181262070-181262092 CCCTTCACTCCTCCCTGGGGAGG + Intergenic
1003233777 6:4277752-4277774 CCCCTTCTTGTTCTCTGTGGGGG + Intergenic
1004918820 6:20357232-20357254 CATTTTCCTGCTCACTGTTGGGG - Intergenic
1005992685 6:30913344-30913366 CCCTTTCCAGCTCCCAGAGCCGG - Exonic
1006257883 6:32845523-32845545 CCCTTTTCTTCTCTCTGTGGTGG - Exonic
1006289912 6:33126771-33126793 CCCTTTTCTGCCTTCTGTGGAGG + Intergenic
1007230744 6:40346019-40346041 TCCCTGCCTGTTCCCTGTGGTGG + Intergenic
1007257751 6:40540706-40540728 TCCTTTCCTTCCCCATGTGGAGG + Intronic
1007461999 6:42025764-42025786 CCCTTTCTGCCTCCCTGGGGAGG - Intronic
1007602327 6:43090248-43090270 TATTTTCCTGCTCCCTGAGGAGG - Intronic
1007633190 6:43283908-43283930 CCCTGTCCTGCTCTCTGAGGAGG + Exonic
1007718286 6:43869960-43869982 CCCCAGCCGGCTCCCTGTGGTGG + Intergenic
1008236810 6:49060668-49060690 ACCTTTCCTGCTTTCTGTTGTGG - Intergenic
1008552228 6:52644275-52644297 CCCATTCCTGCTCCATCTGGAGG + Intergenic
1009482080 6:64171775-64171797 CCATTTCCTTCTCCGTGTGTTGG + Intronic
1010329195 6:74602377-74602399 CCAATTCCTGCTTGCTGTGGTGG + Intergenic
1011164366 6:84429902-84429924 CCCTTTCCTCCTGCCTTTTGTGG + Intergenic
1011754861 6:90488044-90488066 CTCTTTCCTGATTCCTGGGGAGG - Intergenic
1012987506 6:105890670-105890692 CCCTTTCCTCCTCCCTGCTTGGG + Intergenic
1013060541 6:106629640-106629662 CCCTTGCCTGGCTCCTGTGGTGG + Exonic
1013174612 6:107666763-107666785 CTCTTTCTTGCTCTCAGTGGTGG - Intergenic
1013367099 6:109444785-109444807 TCAATTCCTGCACCCTGTGGAGG + Exonic
1018027283 6:159816198-159816220 CCCTCCCCTGCTGCCTGGGGCGG - Intronic
1018071599 6:160168626-160168648 GCCTTACCTGCTCTCTGTGGTGG - Intergenic
1018420280 6:163634968-163634990 CCCTCTCCTGCCCCCTGTGGTGG + Intergenic
1018704187 6:166450670-166450692 CCCTGTGGTGGTCCCTGTGGTGG - Intronic
1018857623 6:167685830-167685852 TCCTTCCCAGCTCCCTGTGCAGG - Intergenic
1018905650 6:168073914-168073936 CCCTGTCTTGCTGCCTGGGGAGG - Intronic
1018919080 6:168158461-168158483 CGCTTTCCTCTGCCCTGTGGGGG - Intergenic
1019218116 6:170456513-170456535 CCCTCTCCAGCTCCATGTCGGGG + Intergenic
1019352474 7:561465-561487 TCCCTTCCTGCTCCCTCAGGCGG + Intronic
1020119486 7:5495165-5495187 CCCCATTCTGCTCCCTGAGGGGG + Intronic
1021997837 7:26198235-26198257 CCCTTAACTGCCCCCTCTGGTGG + Intronic
1022835563 7:34110458-34110480 TCCTTTCCTGAACCCTCTGGAGG - Intronic
1023747403 7:43333964-43333986 CCGTTTCCTGGTCCCAGTGGAGG - Intronic
1023857380 7:44193055-44193077 CTCTGTCCTCCTCCCTGGGGTGG + Intronic
1023987901 7:45108283-45108305 CCAGTTCCTGCTCACTGTGAGGG - Intronic
1024942761 7:54779552-54779574 TCTTTTCCTGCTCCCTGTTGGGG + Intergenic
1025284801 7:57652602-57652624 CCCTTCCCTTATGCCTGTGGCGG - Intergenic
1027315269 7:76981511-76981533 CCTTTAACTGCTCCATGTGGAGG - Intergenic
1028273343 7:88820411-88820433 GCCTCTCCTGCTGCCTGTGAAGG - Intronic
1029350845 7:100011847-100011869 CCCCTTCCCTCTCCCTGGGGTGG - Intergenic
1029896367 7:103989212-103989234 CCCCTTCCAGCTCCCCGTGGTGG + Exonic
1029957661 7:104656569-104656591 CCCTTTCATGCTTCCTGAAGAGG + Intronic
1031627260 7:124005139-124005161 CCCTTTCCTCCTCACTGGGCAGG - Intergenic
1032325729 7:130926638-130926660 CCGTTTCCTGCAGCCTGTGTCGG - Intergenic
1032468333 7:132160807-132160829 CCCCTTCTTGCTGCATGTGGTGG + Intronic
1033245639 7:139714484-139714506 CCCCTTCTTGCTCCCTGTCCGGG - Intronic
1033349021 7:140546763-140546785 CTCCTTCCTTCTCCCTGGGGAGG - Intronic
1033428522 7:141267049-141267071 CCCTTTCCTGCTACCTGAAGAGG + Intronic
1033611783 7:142970294-142970316 CCTTTTCCTGCTCCTTTTGCTGG - Intergenic
1034412081 7:150947105-150947127 CCCTTCCCCACTCCCGGTGGAGG - Intronic
1034970305 7:155414893-155414915 CCCTTTCCTGCTTCCTGTCTTGG - Intergenic
1035805308 8:2448498-2448520 GTCTATCCTGCTCCCTGTAGGGG - Intergenic
1035968669 8:4223389-4223411 CCCTTTCCTGCTTACCTTGGCGG - Intronic
1036106789 8:5849391-5849413 GCTTTTACTGCTCCCTGTGCTGG + Intergenic
1036389308 8:8310748-8310770 CCCTTGTCTGCTTCCTGTGCTGG + Intergenic
1036896082 8:12636554-12636576 CCCTTTGGTGCTCCCTTCGGTGG + Intergenic
1040706381 8:50133617-50133639 CCCTTCCCAGCTTCCTCTGGTGG + Intronic
1041573874 8:59370472-59370494 AACTTGCCTGCTCCCTGTTGTGG + Intergenic
1042077165 8:65008740-65008762 CTCCTTCCTGCTGCCTGTGAAGG - Intergenic
1042814548 8:72864298-72864320 CCCTTTCATGCTCCCTATCAAGG + Intronic
1043670832 8:82882102-82882124 CCCATTCCTTGTCCCTGTTGTGG + Intergenic
1044712686 8:95072834-95072856 CACTTTCTTGCTGCCTGTGAAGG - Intronic
1046255820 8:111694767-111694789 CCTTTTCCTGCTAGGTGTGGTGG + Intergenic
1046765904 8:118069407-118069429 CCATTTCCTCCTCCCTGGGCTGG + Intronic
1049237476 8:141519308-141519330 CCCCTTCCTGGTCCTTGGGGAGG + Intergenic
1049344038 8:142128997-142129019 CGCTCTCCTGCTCCCTCTGCGGG - Intergenic
1049625568 8:143618226-143618248 CCCAGTCCTGCTGCCTGGGGCGG + Intergenic
1050366745 9:4879954-4879976 CCCTTTCCTGTTCCCTAGGTTGG + Intronic
1050409702 9:5350480-5350502 GCCTTTACTCCTCCCTGTTGAGG - Intergenic
1050602086 9:7263147-7263169 CCCTTTCCTGATCTCTGGGTTGG - Intergenic
1052442695 9:28518097-28518119 GCCTCTCCTGCTGGCTGTGGAGG - Intronic
1052785869 9:32827813-32827835 TCCTTTCCTGTTCCCTTTGTTGG - Intergenic
1054842321 9:69756610-69756632 CAATTCACTGCTCCCTGTGGAGG + Intronic
1055132640 9:72793541-72793563 CCCTTTCCTCCTCACTGGGTAGG + Intronic
1056636890 9:88338663-88338685 CCATTTCCTCCTATCTGTGGTGG + Intergenic
1056812646 9:89776421-89776443 CCCTTTCCTGCACATTGTGCCGG - Intergenic
1057221670 9:93260857-93260879 CCCCCTCCTGCTCCCTGGTGTGG - Intronic
1057371652 9:94479635-94479657 CCCCAACCTGCCCCCTGTGGCGG - Intergenic
1057490095 9:95513824-95513846 CCCTTTCCTCCAGCCTGGGGAGG - Intronic
1057490246 9:95515349-95515371 TCCTTTCTTCCTCCCTGGGGAGG - Intronic
1057801904 9:98195915-98195937 CCCTTCCCTGCTCTTTCTGGAGG - Intergenic
1058604447 9:106705726-106705748 CCCTTTCCTCCTCTCTGTGTGGG + Intergenic
1059437716 9:114286504-114286526 CCCATCCCTGCTCACCGTGGGGG + Intronic
1060517952 9:124277500-124277522 CCCTTTCCTGCTGGGTGTTGGGG + Intronic
1060797841 9:126524669-126524691 CCCTTTTCTTTACCCTGTGGAGG - Intergenic
1060815960 9:126635269-126635291 CCCGGGCCTGCTCCCTGTGTGGG - Intronic
1061480692 9:130896466-130896488 CCCCTGCCTGCTCTCAGTGGAGG - Intergenic
1061545033 9:131299513-131299535 CCCTTTCCTGCTGCCCCTGCAGG - Intronic
1061804507 9:133130531-133130553 CCCTTTCTTGTTACCTTTGGTGG - Intronic
1062024088 9:134332500-134332522 CCTGGTCCTGCTGCCTGTGGAGG + Intronic
1062247619 9:135577370-135577392 CCCTGTCCTGCTCCCAGCGCAGG - Intergenic
1062337323 9:136077736-136077758 CCCTTGCCTGCTCCCCGGTGTGG - Intronic
1062344979 9:136110426-136110448 TCCTGTCCTGCCCCCTGCGGAGG + Intergenic
1062681290 9:137782952-137782974 CCCTTCCCTGATCCCGGTGTTGG + Intronic
1185909592 X:3969806-3969828 CCCTTTCCCACTCCCTTCGGGGG - Intergenic
1186082744 X:5951430-5951452 CTCTTTCCTGCTCTCTCTGCTGG + Intronic
1186894089 X:13988633-13988655 CCCTTTCCTGCTCCTAGGAGAGG - Intergenic
1187065994 X:15838529-15838551 CCCTTTGCAGGTCCCTGTGCAGG + Intronic
1189455803 X:41188336-41188358 CCTTTTGCTGCTTCTTGTGGGGG + Intronic
1189545186 X:42035493-42035515 CCCTCTCCTTATACCTGTGGTGG + Intergenic
1190287458 X:48970884-48970906 CCCTTTCCAGATCCATGAGGGGG - Exonic
1192636401 X:72823719-72823741 CCCTGTTCTGTTCCCTCTGGTGG + Intronic
1192645313 X:72897095-72897117 CCCTGTTCTGTTCCCTCTGGTGG - Intronic
1194746641 X:97635672-97635694 TCCTTTCCAGAGCCCTGTGGAGG + Intergenic
1195104845 X:101593844-101593866 TCCCTTCCTCCTCACTGTGGGGG - Intergenic
1195126403 X:101813402-101813424 CTCTTGCCTGCTCCCTGGAGTGG - Intergenic
1195179179 X:102339934-102339956 CTCTTGCCTGCTCCCTGGAGTGG + Intergenic
1195473613 X:105260371-105260393 CCCTTTCCTACTCACTGGGCGGG - Intronic
1195801214 X:108713076-108713098 CCCTTTTCTGCTCCCTCCAGTGG + Intergenic
1196367529 X:114940356-114940378 ACCTTTCCTGCTTTCTGTTGTGG + Intergenic
1198504918 X:137291928-137291950 CCCTTTCCTGTCCCCTTAGGTGG + Intergenic
1199478722 X:148274177-148274199 TCCATTCCTGCTCACTGTGTGGG + Intergenic
1199643991 X:149887439-149887461 CTCTTCCCTGCTACCTCTGGAGG + Intergenic
1202034477 Y:20617954-20617976 GCCTTTCCTGCTTTCTGTTGTGG + Intergenic