ID: 1152279543

View in Genome Browser
Species Human (GRCh38)
Location 17:79377143-79377165
Sequence CTGGCTTTCCACTGCCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 281}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152279534_1152279543 25 Left 1152279534 17:79377095-79377117 CCTTCTAGAGACTCCTTTTCCTA 0: 1
1: 0
2: 2
3: 21
4: 237
Right 1152279543 17:79377143-79377165 CTGGCTTTCCACTGCCCAGCTGG 0: 1
1: 1
2: 1
3: 25
4: 281
1152279540_1152279543 6 Left 1152279540 17:79377114-79377136 CCTAATTAGGCTACTTCTGGGGC 0: 1
1: 0
2: 1
3: 21
4: 491
Right 1152279543 17:79377143-79377165 CTGGCTTTCCACTGCCCAGCTGG 0: 1
1: 1
2: 1
3: 25
4: 281
1152279533_1152279543 28 Left 1152279533 17:79377092-79377114 CCTCCTTCTAGAGACTCCTTTTC 0: 1
1: 0
2: 1
3: 26
4: 292
Right 1152279543 17:79377143-79377165 CTGGCTTTCCACTGCCCAGCTGG 0: 1
1: 1
2: 1
3: 25
4: 281
1152279532_1152279543 29 Left 1152279532 17:79377091-79377113 CCCTCCTTCTAGAGACTCCTTTT 0: 1
1: 0
2: 2
3: 13
4: 292
Right 1152279543 17:79377143-79377165 CTGGCTTTCCACTGCCCAGCTGG 0: 1
1: 1
2: 1
3: 25
4: 281
1152279536_1152279543 12 Left 1152279536 17:79377108-79377130 CCTTTTCCTAATTAGGCTACTTC 0: 1
1: 0
2: 1
3: 20
4: 187
Right 1152279543 17:79377143-79377165 CTGGCTTTCCACTGCCCAGCTGG 0: 1
1: 1
2: 1
3: 25
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152279543 Original CRISPR CTGGCTTTCCACTGCCCAGC TGG Intronic
900151268 1:1180257-1180279 ATGGCTTCCCACCCCCCAGCAGG - Exonic
900368343 1:2320542-2320564 CTGGCTTCACCCTGCCCACCTGG - Intergenic
900496799 1:2979379-2979401 CTCACTTCCCACTGCCCATCAGG + Intergenic
900602924 1:3510753-3510775 CTGCCCTGCCACTGCACAGCTGG - Intronic
900986752 1:6077706-6077728 CTGGCTCTGCTCTGCCCACCGGG - Intronic
901169977 1:7250002-7250024 CTGGCCTCCCCCTGCCAAGCTGG + Intronic
901318187 1:8323090-8323112 CGCGCTGTCCTCTGCCCAGCTGG - Intronic
901639670 1:10686902-10686924 CCGGCTCTCCACTGCCCGGCAGG - Intronic
901702216 1:11051513-11051535 CTGGCTTCCCCCTACCCACCAGG - Intergenic
902229185 1:15016657-15016679 GTGGCTTCCCACTTCCCTGCAGG + Intronic
902384992 1:16071527-16071549 CTGGCTGTCCCCTGCCCACATGG + Intronic
902710917 1:18239153-18239175 CTGGCTTTCCTATGCCCTGTTGG + Intronic
902842118 1:19081421-19081443 GTGGCTCTCCACTGCTCAGGGGG + Exonic
904496052 1:30887335-30887357 CTGGCTTCCCACTCCCAAACTGG + Intronic
905224892 1:36472508-36472530 CTGCCTCACCAGTGCCCAGCTGG + Exonic
907263028 1:53236366-53236388 ATGGCTTTCCACTGCCTTCCTGG + Intronic
907272150 1:53297470-53297492 GTGGCTTTGTACTGCCCAGCGGG + Intronic
909514193 1:76488877-76488899 CTGGCTGTTGACTGTCCAGCAGG + Intronic
913090164 1:115471415-115471437 CTGGGTTTCCATTTTCCAGCAGG - Intergenic
915040053 1:152960827-152960849 CCGGCTTAGCCCTGCCCAGCAGG + Intergenic
915614635 1:157027692-157027714 CAGCCTTGCCACTGCCCATCAGG + Intronic
917436988 1:175031863-175031885 CTGGCTGACCACTTCCAAGCAGG + Intergenic
919077411 1:192830391-192830413 CTAGCTCCCCACTGCCCAACAGG - Intergenic
919920528 1:202164202-202164224 CTGGCATCCCAGTGCCAAGCAGG - Intergenic
920039806 1:203088143-203088165 TTTGCTTTCCCCTGACCAGCTGG + Intergenic
920351193 1:205339143-205339165 CTGGCTGCCCACTGCCCTTCTGG - Intronic
920364823 1:205442609-205442631 ATGCATTTCCACTGGCCAGCTGG + Intronic
920968224 1:210719538-210719560 CTTGCTATCCACTCCCCAACAGG - Intronic
922151153 1:223005408-223005430 CTGGCTTTACTCTGCCCTGCAGG - Exonic
922712772 1:227845684-227845706 CTGGCCTCCCACTGACTAGCAGG + Intronic
1063126642 10:3142068-3142090 CTGGAATCCCACTGCCCAGGGGG + Intronic
1063561447 10:7131627-7131649 CTGGGATTCCATGGCCCAGCAGG + Intergenic
1063697798 10:8354133-8354155 CTGGGTTTCCACTGTTAAGCAGG + Intergenic
1064001862 10:11670434-11670456 CTGGCTAACAACTTCCCAGCAGG + Intergenic
1065894603 10:30152224-30152246 CTGGCTTTCCCCCGCTTAGCTGG - Intergenic
1068955076 10:62814465-62814487 CTGCCTTTCCCCTCCCCAGATGG - Exonic
1069618589 10:69822209-69822231 ATGGCCTTCCACTGGCCACCGGG - Intronic
1070341138 10:75499410-75499432 CTGGCTTCGTACTCCCCAGCGGG + Intronic
1070935242 10:80289061-80289083 CTGGCATTCCATTGCGCAGTAGG + Intronic
1071348398 10:84715322-84715344 CTGGCTCTCCACTAACCAGCTGG - Intergenic
1074445373 10:113517321-113517343 CTGAGTCTCCAGTGCCCAGCTGG + Intergenic
1075718192 10:124569165-124569187 CTGTCTTTCTTCTGCCCAGAGGG + Intronic
1075977393 10:126707591-126707613 CTGGCTTGTCACAGCTCAGCCGG + Intergenic
1076035753 10:127196976-127196998 CTGGCTTCCCAAAGCCCCGCCGG - Intronic
1076472056 10:130725766-130725788 CTGGCATTCCACACCCCACCCGG + Intergenic
1076885412 10:133259961-133259983 GTGGCCGTGCACTGCCCAGCAGG + Intergenic
1077116842 11:889036-889058 CTGGGGGTGCACTGCCCAGCTGG + Intronic
1077285345 11:1763085-1763107 ATGGCCCTCCTCTGCCCAGCTGG + Intronic
1077424644 11:2468924-2468946 CAGCCGTTCCACTTCCCAGCGGG - Intronic
1078222616 11:9364313-9364335 CTGCCTTCCCACTGCCCCACGGG - Intergenic
1079194157 11:18310242-18310264 CTGGCTTTGCTCTGCTCTGCAGG - Intronic
1081618543 11:44604910-44604932 CTGGCTTCTCACTGCCCAACAGG - Intronic
1081687689 11:45054137-45054159 CTGGTTTTCCTCTGGCCTGCTGG + Intergenic
1082572447 11:54759918-54759940 ATGGGCTTCCACTGCCCACCAGG - Intergenic
1084330066 11:68425007-68425029 GGGGCTTTCCACAGCCCAGCTGG + Intronic
1084409219 11:68996855-68996877 CCGGCTTCCCACTGCTCAGAGGG - Intergenic
1084694304 11:70744607-70744629 CTGTGCTTCCACTGCCCACCTGG + Intronic
1084973218 11:72782365-72782387 CTGGGTTTGCACAGCCCAGTGGG - Intronic
1085689417 11:78653193-78653215 CTGGGTTTGCACTTCCCTGCTGG - Exonic
1086414222 11:86572432-86572454 TTTGCTTTCCACTGCCCAACAGG + Intronic
1088706086 11:112465930-112465952 CTGGCTTCCCACTGCTCACTGGG + Intergenic
1090206749 11:124888666-124888688 CTGTCTCTCCACTGCCCATGTGG - Intronic
1090242227 11:125192280-125192302 CTGGCTTTGCACGGCTCTGCCGG - Intronic
1091198268 11:133750262-133750284 AGGGCCTCCCACTGCCCAGCTGG - Intergenic
1091805922 12:3355676-3355698 CTGCCTTTCCTATTCCCAGCGGG - Intergenic
1094159809 12:27378655-27378677 CTGCATTTCCACTGCCCAAGAGG - Intronic
1095301928 12:40594596-40594618 CTGGTGTTCCATTGCACAGCAGG - Intergenic
1096179789 12:49544324-49544346 CTGGTTTTACATTGGCCAGCGGG + Exonic
1096420022 12:51449076-51449098 CTTGCTCTCCTCTGCCAAGCTGG - Intronic
1096613791 12:52820240-52820262 CTGGCCTTCCACAGCCCTGGAGG + Intergenic
1097798026 12:63884608-63884630 CTGGTGTTCTACTGCACAGCAGG - Intronic
1098959177 12:76720202-76720224 CTGGCTCTTCAATGCCCAGACGG + Intergenic
1099455751 12:82860326-82860348 CTGGCTCTCCACACCCCAGATGG - Intronic
1100270455 12:93019719-93019741 CAGGCTTCCCACAGCCCAGGAGG + Intergenic
1102004624 12:109581340-109581362 CTGGCACCCCACTGCCCTGCGGG + Intronic
1102150594 12:110687268-110687290 CTGGCTTCCCAGTGCTTAGCTGG - Intronic
1102254989 12:111410056-111410078 CCGGCTCCCCACTGGCCAGCCGG - Intronic
1102474366 12:113179265-113179287 CTGTCTTGCCACTGCCCGTCCGG + Exonic
1102548507 12:113674053-113674075 CTCGCTCTCCCCTGCCCAGCCGG - Intergenic
1103332117 12:120161573-120161595 CTGGTGTTTCAGTGCCCAGCAGG - Exonic
1105502947 13:20988565-20988587 CTGACTGCCCAGTGCCCAGCAGG - Exonic
1106858744 13:33881739-33881761 CGTGCTTTCCTCTGCCCATCAGG + Intronic
1108690328 13:52853685-52853707 CAGGCATTCCACTGTCCAGGAGG - Intergenic
1110637435 13:77781977-77781999 CTGGCTTCCAGCAGCCCAGCTGG + Intergenic
1112160407 13:96861123-96861145 CTGCCTTCCCACTGCCTGGCTGG + Intergenic
1113800284 13:113082869-113082891 CCGGCTTCCACCTGCCCAGCAGG - Intronic
1114620622 14:24094217-24094239 CTAGCTTTCCTCCGCCCCGCTGG - Exonic
1115849659 14:37580561-37580583 CTGGCTTTTCACTGTCCAGAGGG + Intergenic
1116584978 14:46691970-46691992 CTGTCCTACCACTGCCCAACAGG - Intergenic
1118605936 14:67503536-67503558 ATGGCTGCCCACTGCCCTGCGGG + Intronic
1120016644 14:79481633-79481655 CTGTTTGTCCACTGCCCAGATGG + Intronic
1121124723 14:91398878-91398900 ATGGCTTTCCTCGGCCCAGACGG + Intronic
1121263782 14:92585375-92585397 ATGGATCTCCACTGCCCAGGAGG + Intronic
1121554067 14:94823076-94823098 CTGGATTTCCACTGGGCAGTAGG - Intergenic
1121818401 14:96945509-96945531 ATGGCTTTCCCCTTCCAAGCTGG + Intergenic
1122603557 14:102932945-102932967 CTGACTTCCCTCAGCCCAGCAGG + Exonic
1124372557 15:29111816-29111838 CTGGGGCTCCACTGCCCAGCCGG + Intronic
1126063061 15:44802574-44802596 CTGGCTTTCCACTGAGATGCAGG + Intergenic
1126097867 15:45101943-45101965 CTGCCTGTCCAAGGCCCAGCTGG - Exonic
1126106165 15:45148296-45148318 CTGCCTGTCCAAGGCCCAGCTGG + Exonic
1128532280 15:68462679-68462701 CTGCCTCTCCACTGCCCTCCTGG + Intergenic
1128830799 15:70766811-70766833 CTGGGTATCCTCTGCCCATCTGG - Intergenic
1129487350 15:75887324-75887346 CTCACATTTCACTGCCCAGCTGG - Intronic
1130052350 15:80494397-80494419 CTGCCTTTCCACAGCCAAGGAGG + Intronic
1130251796 15:82304635-82304657 CGGGCCTCCCACTGCCCTGCTGG + Intergenic
1131215949 15:90535284-90535306 CTGGCTTTCTCCTGCCCCTCTGG - Intronic
1131425281 15:92340869-92340891 CTGGCTTATCACAGCACAGCTGG - Intergenic
1132648038 16:1008006-1008028 CTGGCTTTCCACTGCCCAACCGG - Intergenic
1132671290 16:1103157-1103179 ACGGCTTTCCCCGGCCCAGCCGG - Intergenic
1134389734 16:13808337-13808359 CTGGCTTTGCATTCCCCAACTGG + Intergenic
1139698190 16:68690158-68690180 CTGGCCTTCCAAGGCCCAGGGGG - Intronic
1140407725 16:74722073-74722095 AGGGCTTTGCACTGCCGAGCAGG - Intronic
1140712491 16:77691440-77691462 CTGGCTTTCCATTATCCTGCTGG + Intergenic
1140729477 16:77843276-77843298 CTGCCCTCCCACTGCCCAGCTGG - Intronic
1140997975 16:80279541-80279563 ATTGCTTTCCACTTCACAGCTGG - Intergenic
1141480056 16:84300425-84300447 CCAGCTTCCCACTCCCCAGCTGG + Intronic
1141571085 16:84934026-84934048 CAGGCTATCCGCCGCCCAGCCGG + Intergenic
1142015732 16:87745945-87745967 CTGTATTTCTACTGCTCAGCAGG - Intronic
1142731476 17:1861338-1861360 CTCGCTTTCCTGTGCACAGCAGG + Intronic
1143091181 17:4449905-4449927 CTGGCTGTCTGCTGCCCGGCTGG + Intronic
1143357379 17:6340472-6340494 GTGGCTTCCCACTGCCCTCCAGG + Intergenic
1143611614 17:8020971-8020993 ATGGCTGCCCACTGCCCAGCAGG - Intergenic
1144782325 17:17814340-17814362 CTGCCTTGGCACAGCCCAGCAGG + Exonic
1145058374 17:19717411-19717433 CTTGGTTCCCACTGCCCTGCTGG - Intronic
1145294123 17:21574706-21574728 CTGGCTCTCCAAGGGCCAGCTGG + Intergenic
1145369712 17:22298480-22298502 CTGGCTCTCCAAGGGCCAGCTGG - Intergenic
1145978073 17:28995858-28995880 CTGTCCTTGCACTCCCCAGCAGG - Intronic
1147623478 17:41883910-41883932 CCAGCTTTCCACTGCCCACCAGG + Intronic
1147890173 17:43711443-43711465 AGGGCTTTCCACTGCCCCTCAGG - Intergenic
1151660005 17:75514118-75514140 CTGGTGTTCCACAGCCAAGCCGG - Exonic
1152073533 17:78145614-78145636 CTGCCTTTTCTCAGCCCAGCAGG + Intergenic
1152279543 17:79377143-79377165 CTGGCTTTCCACTGCCCAGCTGG + Intronic
1152656595 17:81522772-81522794 ATGGCTGTCTACAGCCCAGCTGG - Intronic
1156310580 18:35918554-35918576 CTGGGTCTCCACTCCTCAGCAGG + Intergenic
1157574127 18:48732393-48732415 CTGGGTGTGCACTGCCCTGCTGG - Intronic
1158890600 18:61868375-61868397 GTGGCTTCCCAGTGCCCTGCAGG - Intronic
1159922344 18:74237457-74237479 CTGGCCTTCCTCTGCCCTGGGGG + Intergenic
1160047993 18:75405788-75405810 CTGGCCTTCCCCTTCACAGCAGG - Intergenic
1160315567 18:77842538-77842560 CTGGGTTTCCACAGCTCATCTGG + Intergenic
1160860695 19:1236271-1236293 CCGGCTTGGCTCTGCCCAGCGGG + Intronic
1160899709 19:1421608-1421630 CTGACTTTCCACTGGGCAGGTGG + Intronic
1161055701 19:2189800-2189822 GTGGCTTGCCCCTGCCCAGAGGG + Intronic
1161270502 19:3387039-3387061 CTGGCTTTCATCAGCCCTGCTGG + Intronic
1161824122 19:6551170-6551192 GTGGCTTCTCTCTGCCCAGCAGG + Intergenic
1163274599 19:16275526-16275548 CTGGCCTGCCAGTGACCAGCTGG + Intergenic
1164615063 19:29662845-29662867 CTGTCCATCCACTTCCCAGCGGG - Intergenic
1164683736 19:30153061-30153083 CTGGCCTTCCCCAGCCCACCCGG - Intergenic
1164720698 19:30429730-30429752 CTGACTCTCCACTGCACACCAGG - Intronic
1164726211 19:30467672-30467694 CTGGCTCTCCAGAGGCCAGCGGG + Intronic
1165739358 19:38196259-38196281 CTGGCGTCTCACTGCTCAGCTGG - Intronic
1166731847 19:45063859-45063881 CTGGGTCTCCACTGCCCTCCAGG + Intronic
927687054 2:25178394-25178416 CTGGCTTTCCACAGGCCACTTGG - Intergenic
929007809 2:37412444-37412466 CTGGCCTCACACAGCCCAGCTGG - Intergenic
930659955 2:54043471-54043493 CTGACTTTCAAATGCCCTGCAGG + Intronic
930992142 2:57669066-57669088 CTTGCTTGCCACTTCCCAACAGG - Intergenic
932347835 2:71007298-71007320 CTGGCTTTCCACCCCTCTGCTGG + Intergenic
932818115 2:74877797-74877819 CTGCATTTTCACAGCCCAGCAGG + Intronic
934113725 2:88765249-88765271 CTGACTTGCCGCTGCCCCGCTGG - Intergenic
936153274 2:110033086-110033108 CCAGGTTTCCACTGCCCAGGAGG - Intergenic
936191407 2:110338329-110338351 CCAGGTTTCCACTGCCCAGGAGG + Intergenic
938243074 2:129757985-129758007 GTGCTTTTCCACTCCCCAGCTGG - Intergenic
938717623 2:134035439-134035461 TTGGGTTTCTACTCCCCAGCAGG - Intergenic
942537765 2:176983293-176983315 ATGGGGTCCCACTGCCCAGCTGG - Intergenic
944311056 2:198234674-198234696 CTGGCTCTCCAATGCCAGGCAGG - Intronic
944474311 2:200088182-200088204 CTGGCTTGCCACTTGCTAGCTGG - Intergenic
946414583 2:219533452-219533474 ATGGCTGTCCACAGCCCTGCCGG - Intronic
946546431 2:220749336-220749358 CTGTCCTTCCCCTGCCCAGGGGG - Intergenic
947997007 2:234536471-234536493 ATGGCTCCCCATTGCCCAGCAGG + Intergenic
948566448 2:238890211-238890233 CTGGCTGACCCCAGCCCAGCAGG - Intronic
1169715865 20:8617021-8617043 CTGGCTTTCTTCTTCCCAGCAGG - Intronic
1170792314 20:19518174-19518196 CTGGCATTTGACTGGCCAGCAGG + Intronic
1172269782 20:33648095-33648117 CTGAATTTCCACTCCCCACCTGG - Exonic
1173363676 20:42366444-42366466 GTGGCTTCCCACTGGCCAGTAGG + Intronic
1173727035 20:45305414-45305436 CTTGCTTCCCTCTCCCCAGCAGG + Intronic
1174371294 20:50089974-50089996 CAGGCTTGCCCCTGCCCCGCAGG + Intronic
1174508602 20:51033841-51033863 ATGGCTTTGCACTGCCCTGTGGG + Intergenic
1176022465 20:62968893-62968915 TTGTCTTTCCACAGCACAGCTGG - Exonic
1176265739 20:64208414-64208436 CTGGCTCTCCCAGGCCCAGCTGG - Exonic
1176694656 21:9959702-9959724 ATGGCTTTCCTCTGTCCTGCTGG + Intergenic
1177240112 21:18444771-18444793 CTGGCATTCCATTGCACAGTAGG - Intronic
1182321852 22:29482775-29482797 CAGGGTTTCCTCTGCCCTGCAGG + Intronic
1182321986 22:29483571-29483593 CTGCCTTGCCCCTGCCCACCTGG - Exonic
1182696736 22:32203540-32203562 GTGGGGTTGCACTGCCCAGCAGG - Intergenic
1183142260 22:35953491-35953513 CTGTCTTTCCCCTTCCCTGCTGG - Intronic
1183329320 22:37211058-37211080 CTGGCTTCCCACTCTCCAGCTGG - Intronic
1184518246 22:44976388-44976410 CTGGTGTTCCATTGCACAGCAGG - Intronic
1184769004 22:46587212-46587234 CTGGCTCATCACAGCCCAGCGGG - Intronic
950116870 3:10456668-10456690 CTGACTTTCCCATGCCCACCAGG + Intronic
950161791 3:10765847-10765869 CTCACTTCCCACTGCCCAGCTGG - Intergenic
950462951 3:13136003-13136025 CTGGGTCTGCACCGCCCAGCAGG - Intergenic
950839051 3:15949406-15949428 CAGTATTTCCAGTGCCCAGCAGG - Intergenic
951205541 3:19922564-19922586 CTGGCTTTCCAGGGCCCAGTGGG - Intronic
952525005 3:34200713-34200735 CTGGCTTTCCACTGAGATGCAGG - Intergenic
952883732 3:38000626-38000648 CTGCCTGTCCACTGCCTACCAGG - Intronic
953228047 3:41038519-41038541 CTGCTTTTCCACTTACCAGCTGG + Intergenic
953400774 3:42614074-42614096 CTGGTATTACAGTGCCCAGCCGG + Intronic
953563931 3:44014977-44014999 ACGGCTTCCCACTGCCCAGATGG + Intergenic
953665898 3:44926259-44926281 CTGACCTCCCACTGCCCAGGAGG - Exonic
953982254 3:47418706-47418728 CCTGCTTCCCAGTGCCCAGCAGG + Exonic
954249812 3:49358722-49358744 CTGGCTGTCCCCTGCACTGCCGG - Intergenic
954577772 3:51686232-51686254 CAGGCTGTCCACTGCCTACCTGG - Intronic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
955079033 3:55640699-55640721 CTGATTTTCCACTCCCCAGATGG + Intronic
955317824 3:57953490-57953512 CTGGCCTTCCACATCCCTGCTGG + Intergenic
956433412 3:69209579-69209601 CTGCATTTCCACTTACCAGCTGG - Intronic
957006807 3:74958004-74958026 CTGGCTTTCTATTGCACAGGGGG - Intergenic
957363677 3:79193441-79193463 CTGGCTCTGCACTGACTAGCTGG - Intronic
959098036 3:101977285-101977307 CTGCCTTTCCACTCCCCCACAGG + Intergenic
960622871 3:119653446-119653468 CTGGTTTGCCACTGGGCAGCTGG - Intronic
961317530 3:126050750-126050772 TTGGCTTTCCACTACCAAACTGG - Intronic
962901483 3:139765707-139765729 ATGGCCTTCCACTAGCCAGCTGG - Intergenic
963315110 3:143750998-143751020 CTGGCTCTCCCCTCTCCAGCTGG + Intronic
964722227 3:159778942-159778964 GTGGCTGTCCACAGCCCAGATGG - Intronic
965542083 3:169880424-169880446 CTGGCCATCCTCTGCCCTGCTGG - Intergenic
968941829 4:3643064-3643086 CTGGCTCTCCACTGCCCTGAGGG + Intergenic
969306125 4:6327242-6327264 CTGGCTCTGCTCTGCCCGGCTGG - Intronic
969343610 4:6557823-6557845 CTGGGTCTCCAGTGCCCAGGTGG - Intronic
971518477 4:27518409-27518431 CTAGTTTTCTACTCCCCAGCAGG - Intergenic
973264038 4:48193376-48193398 CTGGCTTGCCTGTGCCCACCTGG - Intronic
973803228 4:54498916-54498938 CTGGCTTTCCATTTCACAGTGGG - Intergenic
975935164 4:79570694-79570716 CAGGCTGTCAACTGCCCAACTGG + Intergenic
976773039 4:88675158-88675180 CTTGAGTTCCACTGCCCATCTGG + Intronic
977554717 4:98477195-98477217 GTGGCCTTGCACTGGCCAGCGGG - Intronic
978628304 4:110712935-110712957 CTTGCTTTCCCCTGCCCTTCTGG + Intergenic
979552999 4:122012139-122012161 CTGGCTTTCCAATGACAAGGTGG + Intergenic
983550548 4:169012890-169012912 CTGGGTCTCCCCTACCCAGCAGG + Intergenic
984287380 4:177749476-177749498 CTGGTGTTCTACTGCACAGCAGG - Intronic
984827060 4:183935179-183935201 CGGGCTTCCCACTGTCCTGCGGG - Intronic
985545431 5:506591-506613 CTGTCTGGCCACTTCCCAGCAGG + Intronic
985551662 5:536331-536353 CTGGCTCGCCACTTCCTAGCCGG + Intergenic
986438865 5:7760826-7760848 CTGGATTTCTAATGCACAGCTGG - Intronic
986611770 5:9575554-9575576 CTGGCTTCTTACTGCTCAGCCGG + Intergenic
989209025 5:38841755-38841777 TTGGCTTTCCATTGCACAGTGGG + Intergenic
989513811 5:42319062-42319084 CTGCCTTTCCTCTCCCCAACAGG - Intergenic
990519362 5:56563653-56563675 CTGGCTATCCACTTTCTAGCTGG - Intronic
990973468 5:61535635-61535657 GTGGCCTGCCTCTGCCCAGCTGG - Intronic
991645844 5:68799592-68799614 CAGGCTGCCCACTGGCCAGCAGG - Intergenic
993176386 5:84491327-84491349 CTGACTTTCCCCTGTCCATCTGG - Intergenic
993509494 5:88754120-88754142 CTGGCTTCCCACTGGTCAGTGGG + Intronic
994267879 5:97739331-97739353 CTGACCTCCCACTGCCCAGGAGG + Intergenic
997646147 5:135483285-135483307 CTGGGTTGCCACTTCCCACCAGG + Intergenic
998132237 5:139657239-139657261 GTGGCTTGCCACTGCCTAGTGGG + Intronic
998544996 5:143019995-143020017 CTGGCTTAACACTGGCCATCTGG + Intronic
1001044678 5:168362807-168362829 CTGTCTTCCCTCTGCCCTGCTGG - Intronic
1001549025 5:172588602-172588624 CCGGCTGTCCACTGCACGGCTGG - Intergenic
1002001696 5:176199794-176199816 CGCCCTTTCCACTGCACAGCGGG + Intergenic
1002252643 5:177939189-177939211 CGCCCTTTCCACTGCACAGCGGG - Intergenic
1002927932 6:1615360-1615382 CGAGCTTTCCACTGCCGACCTGG - Intergenic
1003068174 6:2920815-2920837 CTCGCTGCCCGCTGCCCAGCTGG + Intergenic
1003405116 6:5821475-5821497 CAGGCTTCCCTCTGCCCAGGTGG + Intergenic
1004426320 6:15509604-15509626 CTGGCTGTCCCCTCCCCAGCTGG - Intronic
1005080576 6:21952876-21952898 CTGGCTCTCCACTTCACAGATGG - Intergenic
1005105491 6:22220481-22220503 CAGGCTTTCCAGTGCCTAGACGG + Intergenic
1006015417 6:31077028-31077050 CTGGCTTGCCTCTGCCCAGGTGG - Intergenic
1006660071 6:35633880-35633902 CTGGCTTCCTAATGCCCGGCTGG + Intronic
1007170314 6:39858196-39858218 ATGGCTTTCCACTGCCCTTAGGG - Intronic
1007342588 6:41201017-41201039 CAGGCCTGACACTGCCCAGCTGG - Exonic
1007714545 6:43848179-43848201 CTGGCTTTGGACTTTCCAGCTGG - Intergenic
1011378048 6:86711710-86711732 GGGGCTTTCTACTGCCCAGAAGG + Intergenic
1017200541 6:151749489-151749511 CTGGTGTTCCATTGCACAGCAGG - Intronic
1017256958 6:152344134-152344156 CTGGCTTTCTGCAGTCCAGCCGG - Exonic
1017769246 6:157632171-157632193 CTGGCTTCCCACAGCACAGAGGG + Intronic
1018371394 6:163171685-163171707 CTACCTTATCACTGCCCAGCTGG - Intronic
1019542728 7:1558859-1558881 CTCCCTGTCCAGTGCCCAGCTGG - Intronic
1019709206 7:2510679-2510701 TTGGCTCCCCACTGCCCAGTTGG - Intergenic
1021643273 7:22761599-22761621 CTGGCTTTCCATTTCCCCACAGG + Intergenic
1022792819 7:33705637-33705659 ATAGCTTTTCACAGCCCAGCAGG - Intergenic
1024022478 7:45384780-45384802 CTGGCTCCCTTCTGCCCAGCTGG - Intergenic
1026019124 7:66694490-66694512 CTGGCTTCCCACTGCCCTCCAGG - Intronic
1026881253 7:73908155-73908177 CTGGCTCCCCACTGCCCTCCAGG + Intergenic
1028416705 7:90588247-90588269 CTGACTTGCCACTCACCAGCTGG + Intronic
1030522322 7:110613175-110613197 TTGCCTTTGCACTACCCAGCTGG - Intergenic
1031683445 7:124703268-124703290 CTGCATTTCCAGTGCTCAGCTGG + Intergenic
1035621999 8:1042130-1042152 CTGGCTTTCCCCAGCCAGGCAGG - Intergenic
1037084009 8:14824169-14824191 CTGGCATTCCACTGCACAGTAGG + Intronic
1038781261 8:30569964-30569986 CTGGCTTGCCCCTGCTCCGCCGG + Intronic
1040600937 8:48883320-48883342 CTAATCTTCCACTGCCCAGCAGG - Intergenic
1041405350 8:57492762-57492784 CTGTCATTCCAGTGCCCTGCGGG + Intergenic
1042152587 8:65804565-65804587 CAGTGTTTCCATTGCCCAGCTGG + Intronic
1045439609 8:102196756-102196778 CTGGCTTTCCACTTGCTGGCTGG - Intergenic
1045439776 8:102197898-102197920 CTGGCTTTCCACTTGCTGGCTGG - Intergenic
1045890034 8:107145177-107145199 CTGGATTCACACTGGCCAGCTGG - Intergenic
1048437734 8:134433575-134433597 CTAGCTTTCAACTGCCCACCAGG + Intergenic
1048581652 8:135733922-135733944 CTGGCTTCCTAGTGCCCTGCAGG - Intergenic
1049284167 8:141765661-141765683 CTGGGACTCCACTCCCCAGCAGG - Intergenic
1049287127 8:141781924-141781946 CTGCCTTTCCCCTGCCTGGCAGG - Intergenic
1052792216 9:32886294-32886316 CAGGCTTTCATCTTCCCAGCAGG - Intergenic
1053285851 9:36849088-36849110 CTGGCTTTGCCCTGACCTGCAGG + Intronic
1053631626 9:39945642-39945664 ATGGCTTTCCTCTGTCCTGCTGG + Intergenic
1053774136 9:41517888-41517910 ATGGCTTTCCTCTGTCCTGCTGG - Intergenic
1054212261 9:62305056-62305078 ATGGCTTTCCTCTGTCCTGCTGG - Intergenic
1054312723 9:63543776-63543798 ATGGCTTTCCTCTGTCCTGCTGG + Intergenic
1056050546 9:82763878-82763900 ATGGCTTTCCACTCCCCATGTGG + Intergenic
1056805555 9:89726171-89726193 CTGCCTTTCCACTGCCAGGCAGG + Intergenic
1057140620 9:92724797-92724819 CAGGCTCTCCACACCCCAGCTGG + Intronic
1060193879 9:121610483-121610505 CTGGCTCTGCCCTTCCCAGCTGG - Intronic
1060405440 9:123370745-123370767 CGGGATCTCCTCTGCCCAGCTGG + Exonic
1060838372 9:126775501-126775523 CTGGCTCTCCCCAGCCCAGCTGG + Intergenic
1061274588 9:129562112-129562134 CTGCCTTCCCACTGCCCAGCTGG - Intergenic
1061292001 9:129655650-129655672 CAGGGTCTCCACTGCCCACCTGG - Intergenic
1062093044 9:134688601-134688623 GTGGCTTTCGGCTGCCAAGCAGG - Intronic
1062289193 9:135786984-135787006 CTGGGTATCCGCTGTCCAGCAGG - Intronic
1186078291 X:5903802-5903824 CTGGTAGTTCACTGCCCAGCTGG + Exonic
1188989768 X:36803336-36803358 CTGGCAATCCACTGCACAGGTGG + Intergenic
1192179491 X:68907506-68907528 CTGGCTCTCCTCTGGCCTGCAGG + Intergenic
1192979092 X:76319363-76319385 TGGGCTTTCCACCTCCCAGCTGG + Intergenic
1200063593 X:153494648-153494670 CAAACTTTCCACTGCCCAGATGG - Intronic
1200385848 X:155890289-155890311 ATGCCTTTCCACTGCCCACAAGG - Intronic
1201517054 Y:14829772-14829794 CTGGTAGTTCACTGCCCAGCTGG - Exonic