ID: 1152280058

View in Genome Browser
Species Human (GRCh38)
Location 17:79379922-79379944
Sequence GGTGCGGGAGAGGCCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 504}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152280058_1152280069 19 Left 1152280058 17:79379922-79379944 CCTGCCGCGGCCTCTCCCGCACC 0: 1
1: 0
2: 1
3: 45
4: 504
Right 1152280069 17:79379964-79379986 CCTCCCTGTCCGCACATCCCCGG 0: 1
1: 0
2: 3
3: 26
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152280058 Original CRISPR GGTGCGGGAGAGGCCGCGGC AGG (reversed) Intronic
900005983 1:51752-51774 GCTGCTGGGGAGGCCGAGGCGGG + Intergenic
900121335 1:1049795-1049817 GGTGAGGGTGGGGCCGGGGCGGG + Exonic
900178977 1:1303104-1303126 GTTGGGGGAGAGGCCGAGGGAGG - Intronic
900256748 1:1701548-1701570 GGTGCGGGGCAGGCAGCGGGGGG + Intronic
900946187 1:5832576-5832598 GGTGTGGGAGGGGGCGCGTCTGG + Intergenic
900970131 1:5987465-5987487 GGTGGGGCAGAGGCAGCAGCAGG + Intronic
901730019 1:11272957-11272979 GGGGCGGGAGGGGGCGGGGCCGG - Intergenic
901803563 1:11723702-11723724 GGTACGCGAGAGGCTGAGGCGGG - Exonic
902785620 1:18730909-18730931 GGTGGGGTAGGGGCCGTGGCGGG + Intronic
902811879 1:18892592-18892614 GGAGAGGGAGAGGCAGGGGCAGG + Intronic
902823386 1:18956723-18956745 GGGGTGGGCGGGGCCGCGGCGGG - Intergenic
902841867 1:19079689-19079711 CATGGGGGAGAGACCGCGGCTGG - Intronic
902938095 1:19779280-19779302 GTTGCGGGTGAGGCAGAGGCAGG - Intronic
903344993 1:22678165-22678187 GATGCGTGGGAGGCCGCAGCAGG + Intergenic
903466447 1:23555148-23555170 GCTGCGGGAAAGAGCGCGGCAGG + Intergenic
903524072 1:23979883-23979905 GGTCGCGGAAAGGCCGCGGCGGG + Intronic
903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG + Exonic
904006594 1:27366327-27366349 GCTGCGGGGGCGGCCGCGGCCGG + Exonic
904799537 1:33082589-33082611 GGTGAGGGAGAGGGGGCAGCAGG - Intronic
904808387 1:33147438-33147460 GATGCAGTAGAAGCCGCGGCTGG + Exonic
905199540 1:36306749-36306771 GGTGCAGGTGAGGCCGAGCCAGG + Exonic
905770880 1:40637117-40637139 GGAGGGGGAGAGGCCAGGGCAGG + Intronic
905804968 1:40869615-40869637 GCTGCTGGAGAGGCTGGGGCAGG + Intergenic
905886823 1:41496225-41496247 GGAGAGGGAGAGGCAGCTGCAGG - Intergenic
906383407 1:45347122-45347144 GGTGCAGGGGAGGCAGGGGCAGG - Intronic
906480932 1:46198432-46198454 GGGGCGGGCCAGGCCGGGGCGGG - Intronic
906640654 1:47438816-47438838 GGTGTGGGTGCGGCGGCGGCAGG - Exonic
907275367 1:53313972-53313994 GGGGCGGGGGAGGCCCAGGCTGG + Intronic
907513808 1:54980823-54980845 GGCGGCGGAGAGGGCGCGGCTGG + Exonic
909419167 1:75444203-75444225 GGTGCTTGAGAGGCTGAGGCAGG + Intronic
911144796 1:94541791-94541813 GGCGCGGGAGAGCGCGCCGCCGG - Exonic
912183348 1:107245122-107245144 GGTGGGGGAGGGACAGCGGCAGG + Intronic
912363468 1:109113848-109113870 GGCGCGGGAGAGCGCGCGCCCGG - Exonic
912670424 1:111619807-111619829 GCAGCGGGAGCGGCGGCGGCAGG - Exonic
912685134 1:111756140-111756162 GGTGCTGGAGGGGCTGCGGGCGG + Exonic
914134226 1:144884052-144884074 GGGGGGGGGGAAGCCGCGGCGGG + Intergenic
914255329 1:145957776-145957798 GGTGCGGGAGGCGGCGGGGCAGG + Exonic
915142438 1:153775903-153775925 GGAGCCGGAGATGCAGCGGCCGG + Exonic
915167860 1:153958534-153958556 GCCGCGGCGGAGGCCGCGGCTGG - Exonic
915246240 1:154558303-154558325 GGGGCCGGAGGGGCCGGGGCGGG - Exonic
915343518 1:155188731-155188753 GGTGCGGTGGAGCCCGGGGCCGG + Intronic
917325390 1:173826110-173826132 GCTGCTGGGGAGGCCGAGGCAGG + Intronic
919728479 1:200898587-200898609 GGGGAGGGAGAGGCCTCTGCTGG + Intronic
919914777 1:202132633-202132655 GGTGAAGGAGAGGCCGAGGGAGG + Exonic
920135986 1:203769769-203769791 GGTGCGGGGGGGGGGGCGGCGGG + Intronic
920704839 1:208243551-208243573 GGCGCGGGAGAAGCCGCCACGGG + Intronic
921891318 1:220356802-220356824 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
922102240 1:222486820-222486842 GGAGAGGGAGAGGCAGAGGCAGG - Intergenic
922194167 1:223345496-223345518 GATGCAGGAGAGGGAGCGGCAGG - Intronic
922586382 1:226737478-226737500 GGAGCGGGAGCCGCGGCGGCGGG - Exonic
923662414 1:235969642-235969664 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
923708651 1:236367339-236367361 GCTACTGGAGAGGCCGAGGCAGG - Intronic
924289737 1:242524745-242524767 GCGGTGGGAGGGGCCGCGGCTGG + Intergenic
924659859 1:246006311-246006333 GGTGCTGGAGGGGCGGCGGGGGG + Intronic
924723342 1:246644275-246644297 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1064230809 10:13528534-13528556 GGTGCGGGGAAGGCGGCGGCGGG + Intronic
1065687667 10:28302656-28302678 GGTGGGGGCGGGGCCGGGGCAGG - Intronic
1067133438 10:43586950-43586972 GGTGAGGGAGTGGCCTCAGCCGG - Intergenic
1067139902 10:43648466-43648488 TGGGAGGGGGAGGCCGCGGCAGG - Intronic
1070103920 10:73414137-73414159 GGAGCCGGAGAGGGCGCTGCGGG + Intergenic
1070179250 10:73998393-73998415 GGCGCGGGAGCGGGCGCGGGAGG + Intronic
1072151809 10:92690110-92690132 GGGGCGGGCGTGGGCGCGGCGGG - Exonic
1072757376 10:98030227-98030249 GCTGGGGGTGAGGCGGCGGCCGG - Intronic
1073121131 10:101123204-101123226 GGTGCGGGGAAGGCCACTGCTGG - Intronic
1073217243 10:101843406-101843428 GGTGCGGGCCAGGCCGGGGTCGG + Intronic
1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG + Intergenic
1074618648 10:115094088-115094110 GGGGCGGGGAAGGCCGCGACGGG - Intronic
1074618657 10:115094109-115094131 GGGGCGGGGGAGGCCGCGAGGGG - Intronic
1075126581 10:119705241-119705263 GCTGCTTGAGAGGCCGAGGCAGG - Intergenic
1076485410 10:130812575-130812597 GATGCGTCAGAGGCCGCTGCTGG + Intergenic
1076635600 10:131880218-131880240 GGTGAGGGAGTGGCCTGGGCAGG + Intergenic
1076662630 10:132065563-132065585 CGAGCGGCAGAGGCCACGGCTGG - Intergenic
1076690938 10:132223634-132223656 GGCTGGGGAGAGGCCCCGGCAGG + Intronic
1076793296 10:132787622-132787644 GGCGCAGGACAGGCCGGGGCGGG - Intergenic
1076839462 10:133038940-133038962 GGTGTCGGGGAGGCCGAGGCTGG + Intergenic
1076886404 10:133264793-133264815 GGTGGGGCAGAGGCTGCAGCAGG - Intronic
1076898631 10:133326120-133326142 GCTGCGGGAGGGGCCGGGTCAGG + Exonic
1077018484 11:407199-407221 GGGGCGGGGGAGGGCGGGGCCGG + Intronic
1077473804 11:2777068-2777090 GGTGCGGGAGAGTCCATTGCAGG - Intronic
1078327046 11:10389331-10389353 GGTGCTGGAGAGACAGCTGCAGG - Intronic
1078514277 11:12009150-12009172 GGTGGGTGAGGGGCGGCGGCGGG - Intronic
1078685026 11:13521483-13521505 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1079242080 11:18728469-18728491 AGTGCGGGTGAGGCCGAGGCAGG + Exonic
1079601537 11:22316767-22316789 GGTGGGGGAGAGACAGAGGCAGG - Intergenic
1080012422 11:27472317-27472339 GCCGCGGGAGAGGCCGGCGCGGG - Exonic
1080456868 11:32426912-32426934 GGTGGGGGAGTGGCCGCGCCTGG - Intronic
1081447324 11:43143336-43143358 GCTGCTGGGGAGGCCGAGGCAGG + Intergenic
1082838448 11:57668457-57668479 GGGGCGGAAGGGGCGGCGGCTGG - Intronic
1083331519 11:61900540-61900562 GGTTGAGGAGAGGCTGCGGCAGG + Intronic
1083342369 11:61967209-61967231 GAGGCGGGAGAGCCCGCGGGTGG + Intronic
1083761032 11:64817890-64817912 GGTGCAGGAGAGCCTGCGGGGGG + Intergenic
1083857427 11:65400062-65400084 GGGGCAGGGGAGGCCGCAGCTGG + Intronic
1084165272 11:67372572-67372594 GGAGCGGGAGGGGGCGGGGCCGG - Intronic
1084189711 11:67493397-67493419 GGTGCAGGAGGTGCGGCGGCTGG - Exonic
1084957046 11:72697118-72697140 GCTGCTGGAGAGCCTGCGGCAGG - Exonic
1085641701 11:78196918-78196940 GGTGCGTGTGCGGCCGGGGCAGG + Exonic
1085785066 11:79441148-79441170 GGTGAGGGAGCGGCCGCGCGTGG - Intergenic
1086064719 11:82733110-82733132 GGCGCGGGAGGGGACGTGGCAGG - Exonic
1086101996 11:83110514-83110536 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1086365859 11:86109774-86109796 GGAGAGGGAGAGGCAGAGGCAGG - Intergenic
1089202925 11:116735635-116735657 GGTGCAGGAGAGGAGGAGGCCGG - Intergenic
1089243059 11:117098243-117098265 GGTCCGCGGGAGGCCGGGGCTGG + Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1089845002 11:121451816-121451838 GGTGGGGATGAGGCCGGGGCCGG + Intergenic
1090037607 11:123262361-123262383 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1090095923 11:123741576-123741598 GGTGGGAGAGAAGCCGGGGCAGG - Exonic
1090329745 11:125921775-125921797 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1091473805 12:753040-753062 GGAGTGGGAGGGGCCGAGGCGGG - Exonic
1091616200 12:2052921-2052943 GGGGCGGGCGCGGGCGCGGCGGG + Intronic
1092169352 12:6363568-6363590 GGTGCGGCAGAGTCCCCCGCAGG + Exonic
1092527030 12:9315616-9315638 GGAGCGGGAGGGGCAGGGGCAGG - Intergenic
1092921424 12:13234908-13234930 GGTGCAGGGGAGGGCGGGGCAGG - Intergenic
1094338969 12:29389540-29389562 GGGTCGGGAGACGCGGCGGCCGG - Intergenic
1096314974 12:50556652-50556674 GCTGCTGGAGAGGCTGAGGCAGG - Intronic
1097264797 12:57738648-57738670 TGTGCGGGGGAGGCAGGGGCGGG + Intronic
1097938459 12:65278774-65278796 GGCGCGGGAGGGTCCGCCGCGGG - Exonic
1100169048 12:91952058-91952080 GTTGCTGGAGAGGCCGGGGTGGG + Intergenic
1101272477 12:103162264-103162286 GGTGGTGGAGAGGCCCCCGCAGG - Intronic
1101997042 12:109533033-109533055 GGTGAGGGCGAGGCGGAGGCTGG - Intronic
1102184000 12:110933712-110933734 GGTGCGGGAGAAGCAGCGGTGGG - Intergenic
1102527005 12:113519658-113519680 CGTGGGGGAGGGGCGGCGGCAGG - Intergenic
1103563460 12:121804247-121804269 GGGGAGGGAGAGGCCGCGGCCGG + Intronic
1103653105 12:122448596-122448618 GGTACTCGAGAGGCCGCGGCAGG - Intergenic
1104289631 12:127455799-127455821 GGAGCGGGAGAAGCCGGGGCCGG + Intergenic
1104376333 12:128267575-128267597 GGTGCGGCGGGGGCCTCGGCGGG + Intronic
1104624055 12:130338311-130338333 GGTGCGGGAGATGCAGGAGCCGG + Intronic
1104624097 12:130338437-130338459 GGTGCGGGAGATGCAGGAGCCGG + Intronic
1104624124 12:130338521-130338543 GGTGCGGGAGATGCAGAAGCCGG + Intronic
1104892065 12:132144832-132144854 ACTGCAGGAGAGGCGGCGGCAGG - Exonic
1104926351 12:132315993-132316015 GGTCCTGGAGAGGGCACGGCAGG + Intronic
1105459089 13:20567083-20567105 GGGGCGGGAGAGAGCGCGGCGGG - Intronic
1105459421 13:20569459-20569481 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1105492613 13:20902945-20902967 GGGGCGGGGGCGGCCGCAGCCGG + Intronic
1106226417 13:27790109-27790131 GGCGCGGGAGAGACCCGGGCCGG - Intergenic
1107654125 13:42574399-42574421 GGTGCGGCGCAGGCGGCGGCGGG - Exonic
1107770920 13:43786914-43786936 GGCGCTGGAGACTCCGCGGCTGG + Intergenic
1109165933 13:59035120-59035142 GGTGCAGGAGAGGCTGAGGGAGG + Intergenic
1113082746 13:106535258-106535280 GGTGCCGGGCCGGCCGCGGCTGG + Intergenic
1113378594 13:109784655-109784677 GGTGCGGGCCGGGCGGCGGCGGG + Exonic
1113494191 13:110714564-110714586 GCTGCGGGGGAGGGGGCGGCGGG + Intronic
1113904373 13:113812556-113812578 GGTGAGGGAGAAGCCGCGGAAGG - Exonic
1113971955 13:114198097-114198119 GGTACTGGAGAGGCTGAGGCAGG - Intergenic
1115217205 14:31025863-31025885 TGTGCGGGAGCTGCGGCGGCTGG - Intronic
1115591987 14:34874142-34874164 AGTGCGCGTGTGGCCGCGGCGGG + Intronic
1115752949 14:36508465-36508487 GTTGGGAGAGAGGCCGCGGGTGG + Intronic
1115851836 14:37595392-37595414 GGGGCGGGAGGCGCGGCGGCCGG - Intronic
1116594343 14:46820428-46820450 GTAGCGGGAGAGGCACCGGCGGG + Intergenic
1117183683 14:53217860-53217882 GTGGCGGGAGAGGCGGGGGCGGG - Intergenic
1117785069 14:59275055-59275077 GGTGTGGGAGGGGCCTGGGCTGG + Intronic
1118514162 14:66508341-66508363 CGTGGGGGAGAGGCCGCGCCGGG - Exonic
1119519696 14:75277095-75277117 GCGACGGGAGCGGCCGCGGCCGG + Intergenic
1119539163 14:75427797-75427819 GGAGCGCGAGCGGCCGCGGGAGG + Intronic
1121417474 14:93788943-93788965 GGCCCGCGAGAGGCAGCGGCGGG + Intergenic
1121544422 14:94753003-94753025 TGTGAGGAAGAGGCCACGGCAGG + Intergenic
1122010418 14:98741753-98741775 GGTACGCGAGAGGCTGAGGCAGG + Intergenic
1122307800 14:100776711-100776733 GGTGCAGGAGGGGCTGGGGCAGG - Intergenic
1122517683 14:102320029-102320051 GGGGCGGGAGCAGGCGCGGCAGG - Exonic
1122581955 14:102777035-102777057 GGTGCGGGCGAGGTGGCCGCGGG + Intergenic
1122597482 14:102903429-102903451 GGTGAGGCAGGGGCCGGGGCCGG + Exonic
1122657764 14:103273642-103273664 GGTGCGGCAGAGGCGTCCGCTGG - Intergenic
1122971366 14:105153564-105153586 GGCCCTGGAGAGGCGGCGGCAGG + Intronic
1123710077 15:22980455-22980477 GGAGCGGCCGGGGCCGCGGCCGG - Intronic
1124453869 15:29822549-29822571 GGAGGGGGCGGGGCCGCGGCGGG + Intronic
1124500770 15:30225193-30225215 GGCCCGGGTGAGGCGGCGGCAGG - Intergenic
1124742800 15:32313474-32313496 GGCCCGGGTGAGGCGGCGGCAGG + Intergenic
1124836118 15:33197535-33197557 GGTACTCGAGAGGCCGAGGCAGG + Intergenic
1125536089 15:40441718-40441740 GATGGGGGAGGGGGCGCGGCGGG - Intronic
1125671726 15:41478287-41478309 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1125929494 15:43590130-43590152 GGTGGGGGAGTGGCTGGGGCTGG - Intronic
1125942661 15:43689962-43689984 GGTGGGGGAGTGGCTGGGGCTGG - Intergenic
1127144097 15:56007250-56007272 GGTGCTGGTGCTGCCGCGGCTGG + Intergenic
1127606343 15:60591947-60591969 GGTCGGGGAGGCGCCGCGGCCGG - Intronic
1128003458 15:64216111-64216133 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1128067769 15:64775320-64775342 GGTGCGGGGGAGGGGGCGGCGGG + Exonic
1128454203 15:67823484-67823506 AGAGCGGGAGGGGCCGCGGGTGG + Intronic
1129678933 15:77647070-77647092 GGTGCGGGAGGGCTCGGGGCTGG + Intronic
1129681286 15:77659833-77659855 GGGGCGGGAGAGGCTGGGGTGGG + Intronic
1130540343 15:84817351-84817373 CGGGCGGGAGCGGCGGCGGCGGG + Exonic
1131091033 15:89625184-89625206 GCTGTGGGAGAGGCGGGGGCAGG - Exonic
1132447532 15:101939171-101939193 GCTGCTGGGGAGGCCGAGGCGGG - Intergenic
1132512697 16:352327-352349 GGGGCGGGCTAGGCCGCGGTAGG - Intronic
1132569358 16:637291-637313 GGGGCGGCAGAGGGCGGGGCGGG + Intronic
1132588856 16:717735-717757 GGTGCGGGCAAGGACGGGGCTGG - Exonic
1132592829 16:733841-733863 GGGGCGGGAGAGGGCGAGGGCGG - Intronic
1132779422 16:1614471-1614493 GGGGCGGCAGGGGCCGCGGCGGG + Intronic
1132915209 16:2340393-2340415 GGGGCGGGCGCGGGCGCGGCCGG + Intronic
1133244412 16:4438203-4438225 GGTGCTGGGGAGGCTGAGGCAGG + Intronic
1133802030 16:9092013-9092035 GGTGGCGGCGAGGCCGCGGGAGG + Exonic
1135047632 16:19168245-19168267 GGGGCCGGAGACGCCGGGGCCGG - Exonic
1136052144 16:27659263-27659285 GGTGCTTGGGAGGCCGAGGCAGG + Intronic
1136411609 16:30080965-30080987 GATGCGGAAGAGGGAGCGGCAGG + Intronic
1137926720 16:52547325-52547347 GGAGAGGGGGCGGCCGCGGCGGG - Intronic
1138436619 16:57004208-57004230 GGTGCAGGAGAGGCCTAGGAGGG + Intronic
1138555678 16:57769989-57770011 GGTGCGGGAGAGAGAGGGGCAGG + Intronic
1139511550 16:67431042-67431064 GGAGCGGGAGGGGCGGGGGCGGG - Intronic
1141111064 16:81271224-81271246 GGTACTTGAGAGGCCGAGGCAGG - Intronic
1141132354 16:81444938-81444960 GGGGCGGGGGAGGCCGAGGGCGG - Intergenic
1141830119 16:86505728-86505750 GGAGCGGGGGCGGCGGCGGCCGG + Intergenic
1141950031 16:87334145-87334167 GGTGCGCGAGAGGGTGCGCCAGG - Exonic
1141989703 16:87602833-87602855 GGGGCAGGAGCGGCGGCGGCGGG - Intronic
1142019340 16:87771174-87771196 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1142497493 17:314147-314169 TGTGCTGCAGAGGCCGCTGCTGG - Intronic
1142547399 17:714540-714562 GGCGCTGGGGAGGCCGCGGCGGG - Intronic
1142586581 17:978633-978655 GGGGCGGGGGAGGCGGGGGCGGG + Intronic
1142586834 17:979348-979370 CGTGCGGGACATGCCGTGGCTGG - Exonic
1142627030 17:1198745-1198767 GGTACTGGAGAGGCTGAGGCAGG - Intronic
1142671010 17:1487412-1487434 GGAGAGGGCGAGGCTGCGGCAGG + Intronic
1143381290 17:6497955-6497977 GGAGCGGGTGAGGCAGCCGCAGG + Intronic
1143514190 17:7411257-7411279 GGGGCAGGGGAGGCAGCGGCTGG + Intronic
1143724258 17:8834637-8834659 GGTACTTGAGAGGCCGAGGCAGG - Intronic
1143750108 17:9021672-9021694 CGGGCGAGAGAGGCGGCGGCGGG + Intronic
1143766057 17:9138468-9138490 GGTCAGGGAGAGGCAGCGTCTGG - Intronic
1145013287 17:19381890-19381912 GGAGCGGGAGAAACGGCGGCAGG + Exonic
1146001684 17:29134211-29134233 GGTGCCGGGGAGGCTGAGGCAGG - Intronic
1147669626 17:42169536-42169558 GCTGCTTGAGCGGCCGCGGCAGG + Exonic
1147793079 17:43025280-43025302 GGGGCGGGGGAGGCGGCGGCGGG + Exonic
1147962614 17:44177263-44177285 TGTGTGGGGGAGCCCGCGGCTGG + Intronic
1148836828 17:50469816-50469838 GGTGCGGGAGGGGGTGGGGCAGG + Intronic
1149867123 17:60157202-60157224 GGTGCAGGAGAGGGGGAGGCAGG + Intronic
1150130575 17:62666700-62666722 GGAGCGGGGGAGGCTGGGGCTGG + Intronic
1150692551 17:67378215-67378237 GGAGCGGGCGAGGCCGGGCCGGG - Intronic
1151283446 17:73093009-73093031 GTTGCGGGAGAGGCTGGGGGCGG + Intergenic
1151498389 17:74473427-74473449 GGTGTGGAGGAGGCAGCGGCAGG - Intronic
1152230289 17:79110936-79110958 GGTGAGGGGTAGGCCGTGGCTGG - Intronic
1152280058 17:79379922-79379944 GGTGCGGGAGAGGCCGCGGCAGG - Intronic
1152409855 17:80117821-80117843 GGTGGGGGAGAGGCCCAGGTGGG + Intergenic
1152527716 17:80898698-80898720 GGTGCGGGGGGAGCCGGGGCGGG - Intronic
1152711164 17:81871097-81871119 GGTGCGGGCTAGGGCGGGGCCGG - Intronic
1152718575 17:81911501-81911523 GGGGCGGGGGAGGCGGGGGCGGG - Intergenic
1152824921 17:82458681-82458703 GTTGGGGGTGAGGCCGCGTCGGG + Exonic
1152919467 17:83058771-83058793 GGGGCCGGAGAGGCTGGGGCAGG + Intergenic
1153285233 18:3450244-3450266 GGCGAGGGAGAGCCCCCGGCCGG + Intronic
1154214869 18:12408306-12408328 GGAGCGGGGGCGGCCGGGGCGGG + Intronic
1156316338 18:35972469-35972491 GGTGCCTGAGAGGACCCGGCAGG + Exonic
1157279093 18:46334164-46334186 GCTGCGGGAGCCGCCGGGGCGGG - Intronic
1157504541 18:48217391-48217413 GCTGCAGGAGAGGCCTCCGCGGG - Intronic
1157555382 18:48610038-48610060 GGTGCTGGAGAGGGCGTGGGCGG + Intronic
1160026039 18:75217062-75217084 GGTGGTGGAGAGGCCTGGGCAGG + Intronic
1160592733 18:79952868-79952890 CGTGGAGAAGAGGCCGCGGCTGG - Intergenic
1160637740 19:93358-93380 GCTGCTGGGGAGGCCGAGGCGGG + Intergenic
1160725421 19:616103-616125 GGCCCGGGTGAGGCGGCGGCAGG - Exonic
1161008144 19:1946722-1946744 GCTGCTGGAGAGGCTGAGGCAGG - Intronic
1161066503 19:2241093-2241115 GGTCCAGGAGAGGCCACGACAGG + Intronic
1161153451 19:2721074-2721096 GGTGGGGGAGGGGAGGCGGCCGG + Intronic
1161168143 19:2799643-2799665 GGGGAGGGAGAGACCGGGGCGGG - Intronic
1161252150 19:3285988-3286010 GCTGCAGGAGGGGCGGCGGCTGG - Exonic
1161343300 19:3754173-3754195 GGTGAGGGGGCGGCCGGGGCCGG - Exonic
1161594148 19:5142633-5142655 GGTGGGGGAGAGGCCCCACCTGG - Intronic
1161800808 19:6415930-6415952 GGTGCGGGGGTGGCCGCAGCCGG + Intronic
1161818171 19:6513024-6513046 GCTGCTGGGGAGGCCGAGGCAGG + Intergenic
1162100216 19:8334652-8334674 GCTGCGGAGGAGGCAGCGGCGGG - Exonic
1162292669 19:9791809-9791831 GGTGAGGGCGAGGCGGGGGCGGG - Intronic
1162292768 19:9792115-9792137 GGTGAGGGGGAGGCGGGGGCGGG - Intronic
1162292789 19:9792172-9792194 GATGAGGGAGAGGCGGGGGCGGG - Intronic
1162292968 19:9792742-9792764 GGTGAGGGAGAGACAGGGGCGGG - Intronic
1162430506 19:10625586-10625608 GGCGCGGGAGAGAGCGCGGGCGG + Exonic
1162746565 19:12801908-12801930 GGTGCGGGGGAGCGTGCGGCCGG + Intronic
1162772411 19:12957116-12957138 GGCGCGGGGGCGGCCGCGCCCGG + Exonic
1163013758 19:14441232-14441254 GGAGCGGGAGCGGCTGCGGCGGG + Exonic
1163023499 19:14496121-14496143 GCTGCGGGAGAGGCCCGGTCTGG - Exonic
1163144958 19:15373809-15373831 GGGGCGGGAGCGGCGGCGGTGGG - Exonic
1163285036 19:16341334-16341356 GCTGCTGGGGAGGCCGAGGCAGG - Intergenic
1163547236 19:17947809-17947831 GGTGGGGGCGGGGCCGGGGCCGG - Intergenic
1163655581 19:18543314-18543336 GGTGCCCGAGGGGGCGCGGCCGG - Intronic
1165433338 19:35784448-35784470 GGGGAGGGAGAGGCCGGGGCGGG - Intronic
1165509264 19:36256803-36256825 GGTGCAGGGGAGGTCGCGTCGGG + Intergenic
1165785718 19:38460536-38460558 GGTGTGTGAGAGGCAGCGACTGG - Exonic
1165803124 19:38565154-38565176 GGCGCGGAGGAGGGCGCGGCGGG + Exonic
1165803231 19:38565565-38565587 GGCGCTGGAGACGCCGCGGAGGG + Exonic
1165922492 19:39307718-39307740 GGGGCTGGAGGGGGCGCGGCCGG - Exonic
1166042894 19:40213990-40214012 GGTGGTGGGGAGGGCGCGGCCGG - Exonic
1166354120 19:42217136-42217158 GGTGCGGGAGCGGCCCTGCCCGG - Intronic
1166694422 19:44844682-44844704 GGAGCTGGTGAGGCCGCGCCGGG - Intergenic
1166733473 19:45071305-45071327 AGTGCGGGCGAGGCCAGGGCAGG - Intergenic
1166876648 19:45901870-45901892 GGTCTGGGAGAGGCGGCGGCGGG - Intronic
1167040607 19:47020785-47020807 GGCGCGGGGGAGGCGGCGGCGGG + Intronic
1167158957 19:47755452-47755474 GCGGCGGCAGAGGCGGCGGCAGG + Exonic
1167379301 19:49129379-49129401 GGTCCGGGAGCGGCTGCGGATGG + Exonic
1167414464 19:49362726-49362748 GGTCTGGGAGAGGAAGCGGCTGG + Intronic
1167466193 19:49652095-49652117 GGAGCGGGAGCGGCGGCGGGCGG - Exonic
1167992090 19:53369352-53369374 GGTGCCTGAGAGGCTGAGGCAGG - Intronic
1168059549 19:53883296-53883318 GGCGCGGGGGAGCCCGGGGCGGG + Intronic
1168293856 19:55369600-55369622 GGAGCGGGAGAGCTGGCGGCGGG + Intronic
1168692776 19:58386746-58386768 GGTGGGGGAGGGGCCGCGTGTGG + Intronic
925328721 2:3042270-3042292 AGAGCAGCAGAGGCCGCGGCCGG - Intergenic
925927201 2:8678979-8679001 CGCGCGGGCCAGGCCGCGGCGGG - Exonic
926243530 2:11105469-11105491 GGTGTGGGAGAGGCAGCCGCCGG + Intergenic
927638873 2:24834463-24834485 GGTGAGGGAGGGGCCGGGGAGGG - Exonic
927682919 2:25151939-25151961 GGAGCGTGAGCGGCGGCGGCAGG + Exonic
928516799 2:32051618-32051640 GGTGCTGGAGAGGCTGAGGTGGG - Intergenic
931681131 2:64750832-64750854 GGAGCAGGGGCGGCCGCGGCGGG + Intronic
931710959 2:64989031-64989053 GCCGCGGGAGAGGGCCCGGCAGG + Intronic
931868250 2:66434095-66434117 GGCCCGGGAGAGGTCGAGGCTGG + Intronic
933206467 2:79513108-79513130 GGGACTGGAGAGGCGGCGGCAGG - Intronic
933745878 2:85570950-85570972 GTTGAGGGAGAGGCCCGGGCTGG + Intronic
933772890 2:85755012-85755034 GGTGGGCGAGTGGCCGGGGCGGG + Intronic
934663785 2:96156798-96156820 GGGCCGGGAGAGGCAGAGGCAGG - Intergenic
934754559 2:96816344-96816366 GCCGCGGGGGAGGCCGCGCCGGG + Exonic
934763913 2:96869979-96870001 GGTGGCAGAGAGGCCGCGGAGGG - Intronic
934845326 2:97658505-97658527 GTAGCGGGAGACGTCGCGGCCGG + Exonic
935629019 2:105196758-105196780 GGGGTGGGAGAGGCTGTGGCAGG - Intergenic
937316667 2:120936010-120936032 AGTGGGGGAGGGGCTGCGGCAGG + Intronic
938289950 2:130143799-130143821 GGGGCGGGAGAGGAGGCCGCGGG + Intronic
938466573 2:131529138-131529160 GGGGCGGGAGAGGAGGCCGCGGG - Intronic
938721600 2:134071950-134071972 GGTGCGCGGGAGGCTGAGGCGGG - Intergenic
942319161 2:174721173-174721195 GGTGTGGGAGAGGGCCAGGCAGG - Intergenic
943302942 2:186226048-186226070 GCTACTGGAGAGGCCGAGGCAGG + Intergenic
943646033 2:190408542-190408564 GGGGCGGGGGAGGCCAGGGCGGG - Intronic
946304413 2:218847563-218847585 GGTGCGGGAGAGGGGGCTTCTGG - Intergenic
946306848 2:218860887-218860909 GGTGGGGGTGGGGCCGGGGCGGG + Intronic
947564558 2:231185712-231185734 GGGGCGGGTGAGGCCACAGCTGG + Intergenic
947713980 2:232330788-232330810 GGAGCAGGGGAGGCCGGGGCTGG - Intronic
947963520 2:234259849-234259871 GGTGAGGGTGAGGCTGAGGCTGG - Intergenic
948354675 2:237368598-237368620 GGTGCAGGAGTGGCTGCGGAGGG + Exonic
948481572 2:238253477-238253499 GGGGCGGGAAAGGGCACGGCTGG + Exonic
948728894 2:239951245-239951267 CGTGCGGGAGGGGCCTCGGGAGG + Intronic
949035673 2:241814755-241814777 GGGGCGGGGGTGGCGGCGGCAGG + Intronic
949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG + Intergenic
1169342839 20:4809568-4809590 GGTGCAGGAGAGGCACAGGCTGG - Intronic
1171401442 20:24875165-24875187 GGTGAGGGAGAGTCCTCGCCTGG - Intergenic
1171500608 20:25589925-25589947 GGCGCAGGAGAGGCCGAGGTGGG + Intergenic
1171877552 20:30592873-30592895 GGGGCGGGAGGGGCCGGGACTGG + Intergenic
1172101639 20:32487358-32487380 GGTGGGGGAGAGGCAGAGGATGG + Intronic
1172446798 20:34997421-34997443 GGAGCTGGGGAGGCTGCGGCGGG + Exonic
1174246938 20:49188417-49188439 GGTGGGGGTGGGGCCGGGGCCGG - Intergenic
1175140144 20:56854998-56855020 GCTGCTCGAGAGGCCGAGGCAGG - Intergenic
1175887972 20:62303049-62303071 GGTGCGGGAGTCGCCGGGCCTGG + Exonic
1176034235 20:63028554-63028576 GGGGCGGGTGGGGCAGCGGCCGG + Intergenic
1176111353 20:63412177-63412199 GGTACCAGACAGGCCGCGGCGGG + Intronic
1176120378 20:63451865-63451887 CGTGCAGCAGAGGCCGCTGCTGG - Intronic
1176586874 21:8595694-8595716 GGGGGGGGAAAAGCCGCGGCGGG - Intergenic
1178494999 21:33078932-33078954 GGTGCGGGACAGACCACAGCAGG - Intergenic
1178561372 21:33642429-33642451 GGGGCGGGGGAGGCAGCGGAGGG + Intronic
1178662729 21:34520999-34521021 GGTGAGGGAAGGGCCGCGGTCGG - Intronic
1178948463 21:36966822-36966844 GGGGGGGGTGAGGCCGCGCCCGG + Intronic
1179213742 21:39349130-39349152 GGGGAGGGGGAGCCCGCGGCCGG - Exonic
1179480236 21:41672278-41672300 CGCGCGGGAGAGGACACGGCTGG + Intergenic
1179522243 21:41953322-41953344 GGGGCGGCAGATGCCGGGGCGGG - Intronic
1179567057 21:42255815-42255837 GGAGCCCGAGAGGCCACGGCAGG - Intronic
1179708424 21:43195582-43195604 TGTGCGGGGGAGGCCGGGGGAGG + Intergenic
1180066819 21:45416439-45416461 GGTGTGGGGGTGGCCGGGGCAGG + Intronic
1180101813 21:45590968-45590990 CCTGCGGGAGAGGCGGAGGCGGG + Intergenic
1180201879 21:46229153-46229175 GGTGCGGGTGGGGGCGGGGCTGG + Intergenic
1180635231 22:17258482-17258504 GGTGGGGCAGGGGCTGCGGCAGG - Intergenic
1180880805 22:19202405-19202427 GGTGCGGGAGGTGCCGTGGATGG - Intronic
1180880817 22:19202441-19202463 GGTGCGGGAGGTGCCGTGGATGG - Intronic
1180951722 22:19723476-19723498 GGTGCGGGCGTGGCAGGGGCGGG + Exonic
1181041506 22:20194751-20194773 GGTGAGGGAGGGGCCTGGGCAGG - Intergenic
1181369079 22:22402351-22402373 GGTGCGTGGGAGGCTGAGGCAGG - Intergenic
1181672458 22:24432110-24432132 GGTGGGGGAGAGGGCGTGGGAGG + Exonic
1181695643 22:24591565-24591587 GGAGCAGGATAGGCCCCGGCTGG + Intronic
1183281223 22:36933696-36933718 GGTGAGAGAGAAGCCGCAGCAGG + Intronic
1183651812 22:39159871-39159893 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1183708174 22:39487716-39487738 GATGCTGGAGAGGCCGCCCCCGG + Exonic
1183829574 22:40410603-40410625 GGTGGGGCATAGGCCGTGGCAGG + Exonic
1185016101 22:48343606-48343628 GGTGCTGGAGAAGCCGCTGTGGG + Intergenic
950086923 3:10265568-10265590 GGTGCTGGGGAGGCTGAGGCAGG + Intronic
950487645 3:13282597-13282619 GGTGCGGGAGGGCGCGTGGCCGG - Intergenic
951411429 3:22372124-22372146 GGGGCAGGGGAGGCCGAGGCGGG - Intronic
952334400 3:32392122-32392144 GGTCCGGGAGCGGACGCGCCGGG + Intronic
953793956 3:45968583-45968605 GGTGCGGGAGAAGCAGCTACGGG - Exonic
953908887 3:46882189-46882211 GGGGCGGGAGAGGCCCGGGAGGG + Intronic
954361332 3:50124317-50124339 GGTGGGGGTGGGGCCGGGGCCGG - Intergenic
954437499 3:50503749-50503771 GGTGGGCGCGTGGCCGCGGCGGG - Intronic
954615690 3:51967734-51967756 GGTGCGGGGAAGGCCGTGGCTGG - Intronic
959056655 3:101574189-101574211 GCTGCAGGGGAGGCCGCGGCGGG + Exonic
960864370 3:122184573-122184595 GGTGGGGGAGGGGCCGTGGCGGG + Intronic
960977932 3:123194657-123194679 GGGGCTGGAGAGGCTGGGGCTGG - Intronic
961373796 3:126449305-126449327 GGTACTCGAGAGGCCGAGGCGGG - Intronic
961604308 3:128082442-128082464 TGTGCTGGGGAGGCCCCGGCGGG + Intronic
961673134 3:128549304-128549326 GGTGGGGGTGGGGCCGTGGCTGG + Intergenic
961780062 3:129316014-129316036 CAGGCGGGAGCGGCCGCGGCCGG + Exonic
961827568 3:129606861-129606883 GGGGCGGGCGGGGCCGGGGCGGG - Intergenic
963044887 3:141095107-141095129 GGTGGGGAAGAGGCCGAGGCAGG + Intronic
963091395 3:141486923-141486945 GGCGGGGGCGGGGCCGCGGCGGG + Intergenic
965911898 3:173788707-173788729 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
966941451 3:184750492-184750514 GTTGGGGGAGAGGCTGCTGCCGG + Intergenic
968231511 3:197007502-197007524 GGTGCTGGAGAGGCCTTGGGAGG - Intronic
968232303 3:197011147-197011169 GGTGCTGGAGAGGCGGTGCCCGG - Intronic
968319133 3:197750102-197750124 AGTGCGGGGGAGGGCGCGGGTGG + Intronic
968585695 4:1414955-1414977 GGAGCGGGCGAGGGCGGGGCCGG - Intergenic
968660082 4:1795238-1795260 GGTGCCGGAGGGGCGGCCGCGGG + Intronic
969723139 4:8904362-8904384 GTTGCGGGGGTGGCCGCGGCTGG - Intergenic
970620347 4:17811205-17811227 GGCGGGCGAGAGGCGGCGGCCGG - Intronic
971801906 4:31303871-31303893 GGTACTGGAGAGGCTGAGGCAGG - Intergenic
972437129 4:39045017-39045039 GGAGCGGGGGAGGCGGGGGCCGG - Intronic
973338927 4:48985166-48985188 GCTGCGCGAGAGGCTGAGGCAGG + Intergenic
973988348 4:56377914-56377936 GGTACTGGAGAGGCTGAGGCAGG - Intronic
976565991 4:86551714-86551736 GCTACTGGAGAGGCTGCGGCAGG - Intronic
976774826 4:88697258-88697280 GCTGCGGCAGAGGCTGCCGCGGG - Exonic
977176839 4:93828995-93829017 GTTGCGGGAGATGATGCGGCTGG - Exonic
977177537 4:93834986-93835008 GAGGCGGCAGAGGCGGCGGCGGG + Intergenic
979468968 4:121072464-121072486 GGGGCGGCAGCGGCCGTGGCGGG + Exonic
981093428 4:140756159-140756181 GGTGCGGCGGCGGCGGCGGCAGG + Intergenic
981128488 4:141132922-141132944 CGGGCCGGAGGGGCCGCGGCCGG + Intronic
981913259 4:150007173-150007195 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
982276332 4:153640089-153640111 GGGGCAGGAGAGGCAGCTGCGGG + Intergenic
984756736 4:183331647-183331669 GGTGTGGGAGGGGCCGTGGAGGG + Intergenic
985615025 5:915044-915066 GGTGCCGGAGAGGCGGGGGGTGG + Intronic
985631791 5:1017778-1017800 GGTGCGGGTGAGGCCGGGCATGG + Intronic
985652284 5:1112567-1112589 GGTGCGGGAGGGGGCGCAGAAGG - Intergenic
985702055 5:1379425-1379447 GGTGCGGGGGAAGCCGGTGCAGG - Intergenic
985743763 5:1635006-1635028 GGGGCGGGAAGGGGCGCGGCAGG - Intergenic
987130369 5:14854726-14854748 GGGGTGGGAGAGGCTGGGGCAGG - Intronic
987767165 5:22247561-22247583 GCTGCAGGAGAGGCTGAGGCAGG + Intronic
992910726 5:81393925-81393947 GCTGCGGGAGCGGCGGCGGCTGG - Intronic
993338590 5:86693029-86693051 GTTGCTGGGGAGGCTGCGGCAGG - Intergenic
993651681 5:90529661-90529683 GGGGCGGGGGAGGACGCGGAGGG + Intronic
994086901 5:95768883-95768905 GGTGGGGGAGAGGCGGAGGGAGG + Intronic
996369348 5:122736690-122736712 GGTGCTGAAGAGGCCAGGGCAGG + Intergenic
997571941 5:134936296-134936318 GCTGTGTGAGAGGCCGGGGCTGG - Intronic
997636132 5:135408522-135408544 GGAGAGGGAGAGGCAGAGGCAGG - Intergenic
998018805 5:138753284-138753306 GGAGCGGGCGGGGCGGCGGCGGG + Intronic
999062766 5:148653993-148654015 GGTGCCGGTGGGGACGCGGCGGG - Intronic
999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG + Intronic
1000014557 5:157266050-157266072 GGTGGGGGCGGAGCCGCGGCGGG + Intergenic
1001328150 5:170744336-170744358 GGTGCGTGAGATGGCGCTGCAGG + Intergenic
1002661322 5:180792691-180792713 TGGGCGGGAGGGGCCGCGGTGGG + Exonic
1003290871 6:4776900-4776922 GGCGGGGGAGGGGACGCGGCGGG - Intronic
1005042296 6:21610226-21610248 GTGGAGGGAGAGGCCCCGGCGGG - Intergenic
1005554178 6:26956620-26956642 GGCGCGCGGGAGCCCGCGGCTGG + Intergenic
1005832402 6:29681167-29681189 GGAGCGGAAGAGGGCGGGGCCGG - Intergenic
1006800916 6:36759291-36759313 GGGGCTGGAGAGGCTGAGGCTGG - Intronic
1007665294 6:43509939-43509961 GCTGCGGCGGAGGCTGCGGCGGG + Exonic
1007772513 6:44202799-44202821 GGTGGGGGAGGGGCAGTGGCTGG - Intergenic
1007816240 6:44527577-44527599 GGAGAGGCAGAGGCCGTGGCAGG + Intergenic
1008629325 6:53348581-53348603 GGTGCGGGTGCGGGCGCGGGCGG - Intronic
1010414893 6:75601872-75601894 GGAGCGGCAGCGGCGGCGGCTGG + Intronic
1010420313 6:75665913-75665935 GGTGCTGGGGAGGCTGAGGCAGG + Intronic
1010968161 6:82235983-82236005 GCTACGGGGGAGGCTGCGGCAGG - Intronic
1011751877 6:90461951-90461973 GGGGAAGGAGAGGCCACGGCTGG - Intergenic
1013204382 6:107933693-107933715 GGAGAGGGAGAGGCAGGGGCAGG - Intronic
1013366229 6:109440515-109440537 GCTGCCGGAGCGGCCGCTGCAGG - Exonic
1014078603 6:117264907-117264929 GGTGTGGGACAGGCGGCGGGAGG + Intergenic
1014230086 6:118893942-118893964 GGAGGGGGCGTGGCCGCGGCGGG - Intronic
1015339963 6:132087018-132087040 GGTGCTTGAGAGGCTGAGGCAGG + Intergenic
1015536143 6:134269410-134269432 GGTGAGGTGGAGGCCGAGGCAGG + Intronic
1015979583 6:138825469-138825491 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1015994900 6:138987800-138987822 GGCGCGTGTGAGGCCGGGGCCGG - Exonic
1018370314 6:163162243-163162265 GGTCAGGGAGAGGCAGCTGCAGG + Intronic
1018686573 6:166308255-166308277 GAAGCCGGAGAGGCCGCGGCTGG - Exonic
1019320097 7:411486-411508 GGGGCTGGAGAGGCTGCGCCGGG - Intergenic
1019320134 7:411594-411616 GGGGCAGGAGAGGCTGCGCCGGG - Intergenic
1019320160 7:411666-411688 GGGGCAGGAGAGGCTGCGCCGGG - Intergenic
1019395811 7:816975-816997 GAGGCGCGGGAGGCCGCGGCGGG + Intronic
1019417243 7:933474-933496 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417254 7:933504-933526 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417270 7:933541-933563 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417301 7:933631-933653 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417312 7:933661-933683 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417323 7:933691-933713 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417354 7:933781-933803 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417395 7:933901-933923 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417416 7:933961-933983 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417427 7:933991-934013 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417466 7:934111-934133 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417487 7:934171-934193 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417498 7:934201-934223 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019529040 7:1494560-1494582 GGTCCGGGGGAGGCTGCGGCTGG + Intronic
1019644263 7:2120753-2120775 GGTGCGGGACAGGAGGCGGGAGG + Intronic
1019989666 7:4682599-4682621 GGTACGGCAGAGCCCGGGGCCGG + Exonic
1020034487 7:4956756-4956778 GGTGTGGGACAGGCCCGGGCTGG + Intronic
1022310725 7:29194262-29194284 GGTGCTGGGGAGGCCGGGGCCGG - Intronic
1025926027 7:65961258-65961280 GGTGCTGGAGAGGCTGAGGCAGG - Intronic
1026615496 7:71899253-71899275 GCTGCTGGGGAGGCTGCGGCAGG - Intronic
1026787913 7:73313344-73313366 GCCGCAGGAGAAGCCGCGGCTGG + Exonic
1026906037 7:74063318-74063340 GCTGCGGCAGCGGCGGCGGCGGG - Exonic
1027656518 7:80936895-80936917 GCTGCTCGAGAGGCTGCGGCAGG - Intergenic
1029673412 7:102049591-102049613 TGTGATGGAGAGGCCGAGGCAGG + Intronic
1029675199 7:102063939-102063961 GTGGTGGGAGGGGCCGCGGCTGG + Intronic
1030033566 7:105389218-105389240 CGGAGGGGAGAGGCCGCGGCGGG - Intronic
1030202246 7:106917502-106917524 GGTACTGGGGAGGCTGCGGCAGG + Intergenic
1031162445 7:118184290-118184312 GGTCGCGGAGAGGCCGCGGTCGG + Intronic
1031899633 7:127393927-127393949 GCTACGGGAGAGGCGGGGGCGGG + Intronic
1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG + Intergenic
1033052877 7:138022199-138022221 GGTGGGGGTGGGGCCGGGGCGGG + Intronic
1034413999 7:150955550-150955572 GGTGCAGGTGAGGCAGTGGCCGG - Intronic
1034491616 7:151396014-151396036 TGCGCGGAGGAGGCCGCGGCCGG - Exonic
1034674707 7:152884105-152884127 GGTGCAGGAGAGGCACCCGCAGG + Intergenic
1034901935 7:154913440-154913462 GGGTGGGGAGAGGCCGCTGCAGG - Intergenic
1035021316 7:155802857-155802879 GGCGCGGGAGGGGGCGGGGCGGG - Exonic
1035153274 7:156892791-156892813 AGAGCGGCAGAGGCCGGGGCGGG + Intronic
1035602684 8:906044-906066 GGTGCTGGGGATGCCGGGGCAGG + Intergenic
1035678768 8:1472284-1472306 GGAGCAGGAGAGGACGCAGCTGG + Intergenic
1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG + Exonic
1036561430 8:9903249-9903271 GGTGCGGGACAGGCAGCCGGAGG + Intergenic
1036888715 8:12580543-12580565 GCTGCGGGGGAGGCTGAGGCAGG - Intergenic
1037482038 8:19314009-19314031 GCGGCGAGAGCGGCCGCGGCGGG + Intronic
1037876103 8:22549342-22549364 GGTTAGGGAGAGGCTGAGGCTGG - Intronic
1038205057 8:25458170-25458192 GGGGCGTGAGGGGGCGCGGCGGG - Intronic
1039424918 8:37477726-37477748 GGTGCAGGAGAGGCCAGTGCTGG - Intergenic
1039527776 8:38231778-38231800 GCTGGGGTAAAGGCCGCGGCCGG + Exonic
1040481578 8:47832025-47832047 GGTGCCGCAGAGGCAGCGACCGG + Intronic
1043542522 8:81280222-81280244 GGTGCAGGAGAGGCGGGGCCAGG + Intergenic
1044821917 8:96160840-96160862 GGGGCGGGAGGGGGCGTGGCGGG - Intergenic
1045564471 8:103299108-103299130 GGTGCTGGGGAGGCAACGGCGGG + Intronic
1047273876 8:123390088-123390110 GGTGCCGGGGAGGCTGAGGCAGG - Intronic
1048285360 8:133137202-133137224 GGTGGGAGAGAGGCCTGGGCTGG - Intergenic
1048866226 8:138763740-138763762 GGTGCAGGGGAGGCAGCGGAGGG - Intronic
1049025207 8:139983762-139983784 GGTGTGAGAGAGGCCGGGGCGGG - Intronic
1049415235 8:142491997-142492019 GGCTCAGGGGAGGCCGCGGCAGG + Intronic
1049558720 8:143296835-143296857 GGTGGGCGCGAGGCCGAGGCCGG + Exonic
1049682854 8:143927415-143927437 TGTGCGGGAGCAGCTGCGGCAGG - Exonic
1049816307 8:144604217-144604239 GGTGCGGGCGAGGCCTCTGTCGG + Intronic
1051621014 9:19049487-19049509 GGGGCTGGAGAGGCCGCGGACGG - Exonic
1052192818 9:25678262-25678284 GGCGCGGGAGTTGCTGCGGCGGG - Exonic
1055699417 9:78926577-78926599 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1056154053 9:83817561-83817583 GCCGCGGGAGAGGCGGCGGCGGG - Exonic
1056356444 9:85805532-85805554 GCCGCGGGAGAGGCGGCGGCGGG + Intergenic
1057222288 9:93263791-93263813 GGTGGGGGTGGGGCCGTGGCGGG + Intronic
1057584164 9:96314593-96314615 GGTGCGGGAGAGGGAGCATCAGG + Intergenic
1058976768 9:110132161-110132183 GCTGCTTGAGAGGCCGAGGCAGG - Intronic
1059313037 9:113401388-113401410 CGTGTGGGCGGGGCCGCGGCTGG - Intergenic
1059445833 9:114337235-114337257 GGTGGGGGAGAGGCTGTGGGCGG + Exonic
1059769689 9:117414297-117414319 GGTCCTGGAGAGCGCGCGGCGGG - Intronic
1060478179 9:124000297-124000319 GGTGCGGGGAGGGCCACGGCAGG + Intergenic
1060770201 9:126326898-126326920 GGCGCGGGAGGGGCCGGGCCCGG - Exonic
1060818080 9:126645873-126645895 GGTGGGGGAGAAGCCGCTGAGGG + Intronic
1061136923 9:128740050-128740072 GATGTGGGAGAGGACGCCGCAGG + Exonic
1061349576 9:130053894-130053916 TGGGCGGGAGAGGAAGCGGCTGG + Exonic
1061363344 9:130157473-130157495 GGGGCGGGAGGGGCGGGGGCCGG - Intergenic
1061423202 9:130483437-130483459 GGGGCTGGGGAAGCCGCGGCTGG + Intronic
1061660648 9:132127985-132128007 GGGGCGGGGGAAGCCGAGGCTGG + Intergenic
1061840653 9:133356796-133356818 GGCAGGGGAGAGGGCGCGGCGGG + Intronic
1062253490 9:135609696-135609718 GGTTGGGGGGAGGCCGCTGCGGG + Intergenic
1062315864 9:135966752-135966774 GGTGGGGGAGGGGCCGCTTCGGG + Intergenic
1062331355 9:136046199-136046221 GGTGCAGGGGAGGCGGAGGCAGG + Intronic
1062444502 9:136587967-136587989 GTTGCGGGGGAGGCGGGGGCGGG + Intergenic
1203563108 Un_KI270744v1:74118-74140 GGTGCTGGAGAGACCTGGGCGGG + Intergenic
1187464434 X:19515125-19515147 GGGGCGGCGGAGGGCGCGGCAGG - Exonic
1194160840 X:90450660-90450682 GGTACGTGGGAGGCCGAGGCAGG + Intergenic
1195350280 X:103989168-103989190 GGTGTGGCAGAGGCAGCGGGGGG - Intergenic
1195891379 X:109699253-109699275 GCTACGGGGGAGGCTGCGGCAGG + Intronic
1196808026 X:119605912-119605934 GGGGCGGCAGCGGCGGCGGCGGG + Intergenic
1197746125 X:129932857-129932879 GCTGCGGGAGGAACCGCGGCCGG - Intergenic
1197765105 X:130055151-130055173 GGTGCTGGAGAGGCCGATCCCGG - Intronic
1199419102 X:147622491-147622513 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1199794047 X:151178178-151178200 CGTGGGGGAGAGGTGGCGGCCGG + Intronic
1200249830 X:154547004-154547026 GGTGCCCGAGAGGCAGGGGCTGG - Exonic
1200507130 Y:4027594-4027616 GGTACGTGGGAGGCCGAGGCAGG + Intergenic
1200684425 Y:6246298-6246320 GGTGCCAGAGAGGCTGCGGCAGG + Exonic
1200687068 Y:6266622-6266644 GGTGCCAGAGAGGCTGCGGCAGG + Intergenic
1200989949 Y:9337539-9337561 GGTGCCAGAGAGGCTGCGGCAGG + Exonic
1200992617 Y:9357872-9357894 GGTGCCAGAGAGGCTGCGGCAGG + Exonic
1200995271 Y:9378151-9378173 GGTGCCAGAGAGGCTGCGGCAGG + Intronic
1200997935 Y:9398496-9398518 GGTGCCAGAGAGGCTGCGGCAGG + Exonic
1201000444 Y:9467030-9467052 GGTGCCAGAGAGGCTGCGGCAGG + Exonic
1201003106 Y:9487342-9487364 GGTGCCAGAGAGGCTGCGGCAGG + Exonic
1201005765 Y:9507625-9507647 GGTGCCAGAGAGGCTGCGGCAGG + Intergenic
1201008425 Y:9527955-9527977 GGTGCCAGAGAGGCTGCGGCAGG + Exonic
1201048207 Y:9908088-9908110 GGTGCCATAGAGGCTGCGGCAGG - Intergenic