ID: 1152282761

View in Genome Browser
Species Human (GRCh38)
Location 17:79395214-79395236
Sequence CCGGACCCAGCAATGTGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152282756_1152282761 11 Left 1152282756 17:79395180-79395202 CCTTTGTTTCATTTGCAGCCACG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1152282761 17:79395214-79395236 CCGGACCCAGCAATGTGTGGCGG 0: 1
1: 0
2: 1
3: 6
4: 101
1152282755_1152282761 12 Left 1152282755 17:79395179-79395201 CCCTTTGTTTCATTTGCAGCCAC 0: 1
1: 0
2: 2
3: 15
4: 247
Right 1152282761 17:79395214-79395236 CCGGACCCAGCAATGTGTGGCGG 0: 1
1: 0
2: 1
3: 6
4: 101
1152282758_1152282761 -7 Left 1152282758 17:79395198-79395220 CCACGATGAGCTGACACCGGACC 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1152282761 17:79395214-79395236 CCGGACCCAGCAATGTGTGGCGG 0: 1
1: 0
2: 1
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152282761 Original CRISPR CCGGACCCAGCAATGTGTGG CGG Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
900786702 1:4654453-4654475 CCGGCCCCCGCAAGGTGGGGCGG + Intergenic
901664646 1:10819462-10819484 GGGGACCCAGCCAGGTGTGGGGG + Intergenic
903670139 1:25030732-25030754 CTGGAAGCAGCAAGGTGTGGCGG - Intergenic
906658481 1:47565805-47565827 CTGGACCCAGCAAGCTGGGGGGG + Intergenic
913543423 1:119843351-119843373 TCGCACCCAAGAATGTGTGGAGG - Intergenic
915715542 1:157941282-157941304 CAGGACCCAGCACAGTGAGGTGG + Intergenic
918041852 1:180918442-180918464 CTGGACCCACCAAGGTGTAGCGG + Intronic
922801082 1:228365082-228365104 CAGGACCCAGCAGTCTGGGGAGG - Intronic
1072499822 10:96002890-96002912 CCGGGTCCAGCCAAGTGTGGTGG + Intronic
1076066040 10:127448497-127448519 TCGGGCCCAGGCATGTGTGGAGG + Intronic
1077184043 11:1228575-1228597 CCGGCCCCAGCAGGGTGCGGTGG - Exonic
1078411878 11:11129346-11129368 CCTGACTCAGCACTGTGTAGTGG + Intergenic
1082916718 11:58445825-58445847 CTGGACAGAGCAGTGTGTGGAGG + Intergenic
1084302660 11:68261640-68261662 GCGGACTCAGAAATGTGAGGGGG - Exonic
1084509079 11:69591826-69591848 CAGGACACAGCAAGGTCTGGTGG - Intergenic
1085035943 11:73300079-73300101 CCACACCCAGCCAGGTGTGGTGG + Intergenic
1094856583 12:34405593-34405615 CTGGGCTCAGCGATGTGTGGTGG - Intergenic
1095775078 12:46001847-46001869 CTGTACCCAGAAATGTGAGGAGG + Intergenic
1097724634 12:63061046-63061068 CCTGAGCCAGAAAAGTGTGGAGG + Intergenic
1104098858 12:125587384-125587406 TCTGACCCAGAAGTGTGTGGGGG + Intronic
1104742848 12:131191364-131191386 CAGGACCCAGCATGGTGTGGTGG + Intergenic
1104898006 12:132173661-132173683 CCGGACCCAGGCAGGTGTGCGGG + Intergenic
1106799720 13:33243655-33243677 CCGGACTCAGCAGGGAGTGGTGG + Intronic
1108751664 13:53453580-53453602 CTAGACCCAGAAATGTTTGGTGG + Intergenic
1109213712 13:59563840-59563862 CTGGACAGAGCAGTGTGTGGAGG - Intergenic
1113510999 13:110854890-110854912 CCAGACCCAGCAGGGGGTGGAGG - Intergenic
1115265007 14:31492295-31492317 ACGGACAGAGCAGTGTGTGGAGG + Intronic
1119892548 14:78193867-78193889 CTGGACCCATCAATGCATGGTGG + Intergenic
1122118821 14:99541038-99541060 CTGGACACAGCAAAGTCTGGAGG - Intronic
1122343393 14:101043382-101043404 CCGGACACACGAATGGGTGGTGG + Intergenic
1122348425 14:101074289-101074311 CCAGAGCCAGCAGTGTGTGGGGG - Intergenic
1122830423 14:104393085-104393107 CTGGGGCCAGCACTGTGTGGGGG + Intergenic
1124642001 15:31401565-31401587 CAGGAACCAGCATTGAGTGGGGG + Intronic
1128245743 15:66131511-66131533 CCAGCCCAAGCAGTGTGTGGAGG + Intronic
1129307741 15:74679973-74679995 CCACACCCAGCCAGGTGTGGTGG + Intronic
1129456112 15:75676941-75676963 CCGGGCCCAGCTGAGTGTGGTGG - Exonic
1132397839 15:101488140-101488162 CAGAAGCCAGCAAGGTGTGGTGG - Intronic
1132958380 16:2608687-2608709 CTGGACCCTGCACTGTGGGGAGG + Intergenic
1132970992 16:2688783-2688805 CTGGACCCTGCACTGTGGGGAGG + Intronic
1135031105 16:19039376-19039398 CCATACCCAGCCAGGTGTGGTGG - Intronic
1135187782 16:20330004-20330026 CTGGAGCATGCAATGTGTGGTGG - Intergenic
1135901450 16:26464083-26464105 CTGGACACAGCGGTGTGTGGGGG + Intergenic
1136630037 16:31484719-31484741 CAGGACGCAGCATGGTGTGGTGG + Exonic
1137780435 16:51093783-51093805 CAGGACCCAGCTCAGTGTGGAGG + Intergenic
1140783666 16:78319140-78319162 TCAAAGCCAGCAATGTGTGGCGG - Intronic
1142965335 17:3577422-3577444 CCTGACCCAGGTATGTGTAGGGG - Intronic
1146067796 17:29650585-29650607 CAGGACCCAGCCATGTGTGGTGG + Intronic
1150142852 17:62744600-62744622 AAGGGCCCAGCAATGTTTGGGGG + Intronic
1151939068 17:77281497-77281519 CCGCTCCCAGGAAAGTGTGGCGG - Exonic
1152282761 17:79395214-79395236 CCGGACCCAGCAATGTGTGGCGG + Intronic
1155159463 18:23183957-23183979 GAGGATCCAGCAAGGTGTGGGGG + Intronic
1155506535 18:26538890-26538912 CCAGACCCAGCAAAGGCTGGGGG + Intronic
1160292026 18:77603674-77603696 GCGGAGACAGCAGTGTGTGGGGG - Intergenic
1160453396 18:78979944-78979966 CCGGAGCCCGCGATGTGAGGCGG + Intergenic
1166012275 19:39951293-39951315 CCTGACCCAGCATGGTATGGAGG + Intergenic
925538779 2:4944027-4944049 ACTGACCCAGCAATGTGTAGTGG + Intergenic
931547742 2:63408110-63408132 CCAGACAGAGCAGTGTGTGGAGG + Intronic
935523620 2:104140270-104140292 CTGGTCCTGGCAATGTGTGGGGG - Intergenic
937115141 2:119399476-119399498 CTGGACCCAGCAGTGGGTGTGGG - Intergenic
937248926 2:120511290-120511312 CCGGACCCAGCAAGGGCTGGGGG + Intergenic
938038303 2:128054502-128054524 CTGGACACAGCAGTGTGTGGAGG - Intergenic
938903251 2:135816333-135816355 CAGGACCCAGCAATGAGTTCAGG + Intronic
940760822 2:157737373-157737395 TCGTACCCAGCCATGTGTTGGGG - Exonic
1172196689 20:33096761-33096783 CTGGACCCAGCAATGTGTCCTGG + Intronic
1172579381 20:36034848-36034870 CCATACCAAGCACTGTGTGGGGG + Intergenic
1173401688 20:42731560-42731582 CCAGGCCCAGCACTGTGTGAAGG + Intronic
1176425981 21:6548440-6548462 CCTGACCCAGAAATGACTGGAGG - Intergenic
1177888894 21:26781085-26781107 GCAGACCCAGCCAAGTGTGGTGG - Intergenic
1179701472 21:43156757-43156779 CCTGACCCAGAAATGACTGGAGG - Intergenic
1184533197 22:45070108-45070130 CCTCAACCAGCAATGTGGGGAGG + Intergenic
957798781 3:85047507-85047529 CAAGACCCTGCAATGTGTGATGG + Intronic
960057752 3:113287268-113287290 CCGGATCCAGCCATCTGTGTGGG - Exonic
965185727 3:165460305-165460327 CCCGACCCAACAATGTGGGTGGG + Intergenic
974131393 4:57760728-57760750 TAGGAACCAGGAATGTGTGGTGG - Intergenic
974203380 4:58669259-58669281 CTGGACCCAGCTACGTGAGGAGG + Intergenic
978309183 4:107367112-107367134 CTGGAACCTGCAATGTGTGTTGG + Intergenic
979813113 4:125064638-125064660 CTGGACCCAGCAATGTGGCTGGG + Intergenic
983045822 4:162985199-162985221 CAGGACCCAGCCATCTCTGGAGG + Intergenic
985840952 5:2305368-2305390 CAGGACCCAGCAATCTCTGAAGG + Intergenic
985841386 5:2308386-2308408 CATGACTCAGCAATGTGTGCAGG - Intergenic
986868348 5:12016275-12016297 CTGAACCCAGCCCTGTGTGGAGG + Intergenic
988902082 5:35744822-35744844 CTGGACAGAGCAGTGTGTGGAGG + Intronic
992260754 5:74967813-74967835 CTGGACACAGCAGTGTCTGGGGG - Intergenic
994763752 5:103889770-103889792 CTCGACCCAGCAATGTGGGCAGG - Intergenic
998406366 5:141876776-141876798 CGGGACCCACCAAGGTGTGTGGG + Intronic
1011893442 6:92194863-92194885 TCGGACAGAGCAGTGTGTGGGGG - Intergenic
1013542215 6:111122085-111122107 CAGGACCCAGCAAGAGGTGGAGG - Intronic
1015970871 6:138741590-138741612 CAGGAAGCATCAATGTGTGGTGG - Intergenic
1018945851 6:168346242-168346264 CGGGAACCAGCAGCGTGTGGAGG + Intergenic
1019348220 7:540908-540930 CTGGACCCTGGAAGGTGTGGTGG + Intergenic
1024918028 7:54525402-54525424 ACGGACAGAGCACTGTGTGGAGG - Intergenic
1028952577 7:96653524-96653546 CAGGACCCAGCAATGGGAAGAGG + Intronic
1030230986 7:107208220-107208242 CTGGAATCAGCCATGTGTGGAGG + Intronic
1033656143 7:143375992-143376014 CAGCAGCCAGAAATGTGTGGTGG - Intergenic
1038318727 8:26509627-26509649 CCAGACACACCACTGTGTGGAGG - Exonic
1038367349 8:26949209-26949231 CCAGACAGAGCAGTGTGTGGAGG - Intergenic
1041227619 8:55716399-55716421 CTGGACAGAGCAGTGTGTGGGGG + Intronic
1053002636 9:34585769-34585791 CCAGACCCACCATTGGGTGGGGG - Intronic
1054266842 9:62925860-62925882 CCGGAGCCAGCAGGGGGTGGCGG + Intergenic
1054550335 9:66595314-66595336 CCGGAGCCAGCAGGGGGTGGCGG + Intergenic
1060927962 9:127468408-127468430 CCGGAGCCAGCACTGGCTGGAGG + Intronic
1061258157 9:129464849-129464871 CCGGAGCCAGCAAGGTGGGATGG + Intergenic
1061406452 9:130395213-130395235 CGGGGCCCAACAATGTTTGGAGG - Intronic
1062265041 9:135683143-135683165 CCCGACCCAGAAAAGTGAGGGGG + Intergenic
1191104031 X:56761243-56761265 CAGGACCCAGGTATGAGTGGAGG - Intergenic
1192212585 X:69137206-69137228 GCGGGCTCAGCGATGTGTGGCGG + Intergenic
1198843091 X:140880221-140880243 CCAGACAGAGCAGTGTGTGGAGG + Intergenic
1201408335 Y:13672372-13672394 GCAGACACAGCAGTGTGTGGAGG + Intergenic