ID: 1152291493

View in Genome Browser
Species Human (GRCh38)
Location 17:79442481-79442503
Sequence GCAAGGCCCCTTGTGGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152291483_1152291493 27 Left 1152291483 17:79442431-79442453 CCAAGCAGGGCTGGGTGAGTTGG 0: 1
1: 0
2: 2
3: 41
4: 387
Right 1152291493 17:79442481-79442503 GCAAGGCCCCTTGTGGTGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152291493 Original CRISPR GCAAGGCCCCTTGTGGTGAG AGG Intronic
900485820 1:2922204-2922226 CCGAGCCCCCTGGTGGTGAGTGG + Intergenic
900748366 1:4377010-4377032 GCAAGCCCCCTTGTGCTGCGAGG + Intergenic
900922650 1:5683321-5683343 ACAAGGGCCCTGGGGGTGAGTGG - Intergenic
907116182 1:51970465-51970487 TCAGGGACCTTTGTGGTGAGGGG + Intronic
907998837 1:59660083-59660105 GCAAATCCCCTTTTTGTGAGCGG - Intronic
910337727 1:86154405-86154427 GCAAGGCCTCTGGTGGTCATGGG + Intronic
915107320 1:153542558-153542580 GAAAAGCCCCATGTGATGAGAGG + Intergenic
916786411 1:168090228-168090250 GCAAGGCCCCTCTGGGTCAGTGG + Intronic
918055934 1:181022410-181022432 GCCAAGCCCCTGGTGGTGGGGGG - Intronic
919913937 1:202128703-202128725 GAAAGGCCCTGTGTGGGGAGGGG - Exonic
920350783 1:205336657-205336679 GCTAGGCCTCTGGTGGGGAGGGG + Exonic
921874240 1:220176448-220176470 GCCAAGCCCCTTGTGGGGACTGG - Intronic
1063161136 10:3419953-3419975 GCAGGGCCCCTGAAGGTGAGAGG + Intergenic
1063915032 10:10872873-10872895 GAAAGGACACATGTGGTGAGAGG + Intergenic
1064244216 10:13656628-13656650 GCAAGGCCACGTCAGGTGAGAGG - Exonic
1064672540 10:17731377-17731399 GCAGGGCCCTTGGTGGGGAGGGG + Intergenic
1067333271 10:45341131-45341153 GCCAGGCCAGTTTTGGTGAGTGG - Intergenic
1067344372 10:45427354-45427376 TCAGGGCACCTTGTGTTGAGGGG - Intronic
1067794306 10:49309657-49309679 GCAAGGCACCCTGTGGCGTGGGG + Intronic
1072043079 10:91627956-91627978 GCACTGCTCCTTGGGGTGAGAGG - Intergenic
1073179461 10:101575018-101575040 GCAAGGCCCCAGGGGCTGAGGGG - Intronic
1074182049 10:111074176-111074198 GCAAGTGCCCTTGTGGGGACAGG - Intergenic
1075520611 10:123141497-123141519 AAAAGGCCCCTTTTTGTGAGTGG - Intergenic
1076216967 10:128702578-128702600 GCCATGCCGCTTCTGGTGAGTGG + Intergenic
1078021074 11:7656321-7656343 GCAAGGCCCATTGGGATGACAGG + Intronic
1078417729 11:11179907-11179929 TCAAGGCACCTTTTGGGGAGGGG - Intergenic
1080198075 11:29635058-29635080 CCAAGGCAACTTTTGGTGAGCGG - Intergenic
1081282859 11:41231602-41231624 CCAGGGCCCCTTGTGGGGTGGGG + Intronic
1084872066 11:72105114-72105136 GCAAGGCCCCTGGTGATGGCGGG - Intronic
1087046732 11:93849611-93849633 GCAGGGCCGCTGGAGGTGAGAGG - Intronic
1090744660 11:129696233-129696255 GCAGGCCCCCTTGTGGTCAGAGG + Intergenic
1096085268 12:48861440-48861462 GTGAGGCCCTTTGGGGTGAGGGG - Intronic
1096283961 12:50282393-50282415 GCAATGCCCATTTTGGGGAGAGG - Intronic
1097233002 12:57523287-57523309 ACAGGGCGCCTTGTTGTGAGAGG + Intronic
1097394957 12:59061941-59061963 GCAATGTCCCTTGTGTTGATTGG - Intergenic
1100708287 12:97226075-97226097 ACAAGGCATCATGTGGTGAGAGG + Intergenic
1102634457 12:114310842-114310864 TCAAGACACCTTGTGGTGTGTGG + Intergenic
1103122406 12:118391675-118391697 GCAAGTCCCTCTGTGGTGATGGG + Intronic
1103357511 12:120332538-120332560 GCAAAGCACCTGGTGGGGAGGGG + Intergenic
1103596378 12:122026699-122026721 GCCAGGCCTCTTGAGGTGACAGG + Intronic
1104270359 12:127277956-127277978 GCATGGCTCCTGGTGGAGAGTGG + Intergenic
1104872771 12:132012376-132012398 GCAAGGCCCCATCTGGGAAGCGG - Intronic
1106603748 13:31208969-31208991 GCAGGGTCCCTTGAGGGGAGGGG - Intronic
1114875147 14:26707451-26707473 GCAACATCCCTTGTGGTGAAAGG + Intergenic
1116799624 14:49429310-49429332 GCCAAGCCCCGTCTGGTGAGGGG - Intergenic
1119170781 14:72534868-72534890 ACAAAGGCCCTAGTGGTGAGGGG - Intronic
1119687611 14:76645104-76645126 GCCTGACCCCTTGTGGTGTGAGG + Intergenic
1119788326 14:77328760-77328782 GCATGGTCCCTTGTGAGGAGAGG - Intronic
1122623989 14:103075045-103075067 GCAAGGTCCCCTGCGGTGGGCGG + Intergenic
1122853807 14:104550471-104550493 AGAAAGCCCCTTGTAGTGAGTGG + Intronic
1202894760 14_GL000194v1_random:586-608 GCACAGCCCCTTGTGGGGATTGG - Intergenic
1126859603 15:52871130-52871152 GCAAGGCACCTAGTGTTGTGTGG - Intergenic
1128389742 15:67174903-67174925 GCAAAGCCACTTCTGGTAAGGGG + Intronic
1128400531 15:67275308-67275330 GCAAGGCAGATTGTGGAGAGAGG + Intronic
1128412042 15:67409350-67409372 CCACAGCCCCCTGTGGTGAGAGG + Intronic
1128908564 15:71491458-71491480 GCAAGGTATCATGTGGTGAGGGG - Intronic
1134826594 16:17289452-17289474 ACAAAGCCCCTTGAGTTGAGAGG - Intronic
1136174652 16:28508306-28508328 GCGAGGCCCCATGTGGTCAAGGG - Intronic
1137336917 16:47558772-47558794 GCAAGACCACTTGAGGTCAGGGG - Intronic
1137570950 16:49566041-49566063 GCAAACCCCCTGGTGGTCAGTGG + Intronic
1139547583 16:67656867-67656889 TCCAGGCCCCTGCTGGTGAGGGG + Exonic
1140196277 16:72858164-72858186 CCACGGCTGCTTGTGGTGAGAGG - Intronic
1141631815 16:85291852-85291874 TAAGGGCCCTTTGTGGTGAGAGG - Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1143781010 17:9229793-9229815 GGAAGACCCCTGATGGTGAGGGG + Intronic
1146789351 17:35742752-35742774 GCAAGGTCCCTTGTTATAAGAGG + Exonic
1148758425 17:49986697-49986719 GCAAGGCAGTTGGTGGTGAGTGG - Intergenic
1149043530 17:52218554-52218576 TCAAGGGCCCTTGTGGTGGCTGG + Intergenic
1151632918 17:75323270-75323292 GCGAGGCATCTTGTGCTGAGTGG - Intronic
1152008079 17:77694938-77694960 GCAAGGCCCTTTGCTGGGAGTGG - Intergenic
1152291493 17:79442481-79442503 GCAAGGCCCCTTGTGGTGAGAGG + Intronic
1153774092 18:8437604-8437626 GCAAGGGCACTGGTGCTGAGTGG - Intergenic
1153983408 18:10332016-10332038 GCCAGGACCCTCGTGGTCAGGGG - Intergenic
1156353612 18:36322425-36322447 GTAAGGCCCCTTCTGTTGTGGGG + Intronic
1157573839 18:48730783-48730805 GAAGGGCCCCCTGTGGTGTGAGG + Intronic
1166125929 19:40715317-40715339 ACAAGGCACTTTGAGGTGAGTGG - Intronic
1167434962 19:49474143-49474165 GCGCGCCCCCTGGTGGTGAGAGG - Intronic
925410049 2:3634807-3634829 GCAGGGCCCCCTCTGGTGTGGGG + Intronic
928091403 2:28377205-28377227 GCGAGGTCCCTTGGGGTGGGAGG + Intergenic
931208707 2:60172038-60172060 GCAAGTTTCCTTGTGGGGAGAGG - Intergenic
932809249 2:74810416-74810438 GAAAGGCTCCTGGAGGTGAGTGG + Intergenic
933811839 2:86037434-86037456 GCCAGGCCCCATAAGGTGAGAGG + Intronic
942228456 2:173837352-173837374 GCATGGCCCATCTTGGTGAGTGG - Intergenic
942497905 2:176558979-176559001 GCAGGGCCCTTTGTGGAGAATGG - Intergenic
942557696 2:177188691-177188713 GAGAGGCCCCTTCTGGTGTGTGG - Intergenic
945285493 2:208077822-208077844 ACAGGGGCCCTTGTGGGGAGCGG + Intergenic
945318447 2:208394680-208394702 GCAAGGCCCCTTTAAGGGAGGGG + Intronic
946170953 2:217895213-217895235 GCCAGGCCCCTGGCCGTGAGAGG - Intronic
948798783 2:240420702-240420724 GCCAGGCCATTTGTGCTGAGGGG - Intergenic
948800221 2:240430062-240430084 GCAAGGCCTCTTCTGGGGACAGG - Intergenic
948982660 2:241502371-241502393 GAATGGCCCCTGGGGGTGAGGGG + Intronic
949046423 2:241874518-241874540 CCAGGGCCCCTGGTGGGGAGGGG + Intergenic
1174509854 20:51042849-51042871 ACATTGCCCCTTGTGGTGAGTGG + Intergenic
1175121149 20:56717240-56717262 TCAAGGCCCCTTATGGTGCTGGG - Intergenic
1176249191 20:64112199-64112221 GCAAGGCCCCTGGGGGAAAGAGG + Intergenic
1176268871 20:64225106-64225128 GAAAGGCCCCTGGGGGAGAGTGG - Intronic
1176614459 21:9016573-9016595 GCACAGCCCCTTGTGGGGATTGG - Intergenic
1176710744 21:10147298-10147320 GCACAGCCCCTTGTGGGGATTGG + Intergenic
1178633312 21:34281139-34281161 GGAAGGCCCCATGTGGAGACGGG - Intergenic
1179177213 21:39017108-39017130 GCAGGGCAACCTGTGGTGAGAGG + Intergenic
1179601500 21:42480735-42480757 GCCAGGGCCCTTGGGGTGAAAGG + Intronic
1179727368 21:43347972-43347994 GCAAGGCCCCTTCCGGAGACGGG - Intergenic
1183298523 22:37046453-37046475 GCCAGGCCGGTTGTGGGGAGGGG + Intergenic
1183521315 22:38297692-38297714 ACCAGGCCCCTTGTGGGCAGTGG + Intronic
950005332 3:9687717-9687739 TCAAGGCCCCTGCTGGAGAGCGG - Intronic
950555581 3:13693878-13693900 GCAAGGCATCATATGGTGAGGGG + Intergenic
950864895 3:16181352-16181374 GCAAGGCCCCAGGTGGTCAATGG + Intronic
951550168 3:23869493-23869515 ACAAGTCACCTTGGGGTGAGGGG - Intronic
953490657 3:43347639-43347661 GCAAAACCACTTGTGTTGAGAGG - Exonic
953744486 3:45563626-45563648 GCAGGGCATCATGTGGTGAGGGG - Intronic
954418367 3:50405349-50405371 GCAAGGGCCGTGGTGGGGAGGGG + Intronic
955466132 3:59238879-59238901 GGAAGGCCCTTTGTGGGGAATGG - Intergenic
956334688 3:68150012-68150034 GCAAGGTCTCTTGTGCTGAGAGG + Intronic
960158072 3:114318242-114318264 GCAAGATCCCTTGTGCTCAGTGG + Intergenic
961318458 3:126056456-126056478 GCAAGACCCCATGTGGGGACCGG + Intronic
963781153 3:149487781-149487803 CCCATGCCCCTTGTGGTGACAGG - Intronic
966878855 3:184338532-184338554 GCTGGGCCCCTGGTGGTGGGGGG + Intronic
969863311 4:10054825-10054847 GCAAGACCCGAGGTGGTGAGTGG - Intronic
974071679 4:57129723-57129745 GCAAGACCCCATCAGGTGAGTGG - Intergenic
981306764 4:143254694-143254716 GGAAGCTCCCTTGTGGAGAGAGG - Intergenic
984003350 4:174278703-174278725 GCAATGGCCTTTGTGGTTAGTGG - Intronic
984385198 4:179047293-179047315 TCAAGGCCCCGTGTGAGGAGTGG - Intergenic
984917091 4:184734357-184734379 GGACGGCCCCTTGTGGGGTGGGG + Intergenic
986562892 5:9081046-9081068 GGAAGTTGCCTTGTGGTGAGTGG + Intronic
989495924 5:42111772-42111794 CCATGGACCCTCGTGGTGAGTGG - Intergenic
998684481 5:144508371-144508393 GCAAGACCCCTTCTGGTATGAGG + Intergenic
1000614561 5:163413028-163413050 GCAGGGCCCCTTGAAGTGGGCGG + Intergenic
1001665858 5:173433376-173433398 GCAAGGCCCCTTAAAGGGAGGGG + Intergenic
1002467842 5:179416634-179416656 GCCAGGCCCCTTGTGGCGTGTGG - Intergenic
1003981395 6:11393619-11393641 GCAAGGCCCTATGTGGTTTGTGG - Intergenic
1004158787 6:13195039-13195061 GACTGACCCCTTGTGGTGAGAGG - Intronic
1005119160 6:22371221-22371243 GCAAGGCCCCTTTAAGGGAGGGG - Intergenic
1007728252 6:43929853-43929875 GCATGTCCCCTGTTGGTGAGGGG + Intergenic
1008450600 6:51646306-51646328 GTGAGGCCCCTTGTGCAGAGAGG + Intronic
1012451302 6:99354890-99354912 GCAAAGCACCTTATGGTGAGAGG - Intergenic
1015403788 6:132814914-132814936 GCAAGGCCTTATGTGGTGTGAGG + Intronic
1019593770 7:1848861-1848883 GCAAGGACCTTGGTGGTGGGGGG - Exonic
1022184339 7:27952427-27952449 GCAAAGCCCCTCGTGGAAAGTGG - Intronic
1023493142 7:40765851-40765873 GGAAGGGGCCTTGTGGTCAGAGG - Intronic
1023943406 7:44784756-44784778 GCAAGGCCCCTTGTGTTAGGAGG + Intergenic
1026776651 7:73235022-73235044 GCAAGGGTCCTTGTCGTGACGGG + Intergenic
1027017503 7:74788392-74788414 GCAAGGGTCCTTGTCGTGACGGG + Intronic
1027070520 7:75157540-75157562 GCAAGGGTCCTTGTCGTGACGGG - Intergenic
1029033467 7:97493067-97493089 GAAAGGCAGCATGTGGTGAGTGG - Intergenic
1032428046 7:131837696-131837718 AGAAGGGCCATTGTGGTGAGTGG + Intergenic
1032444453 7:131969936-131969958 GGAAGGTCCTTTGTGGTGATGGG - Intergenic
1034788232 7:153944597-153944619 GCAAGGCCCCGTGTGTTGTGAGG - Intronic
1049660942 8:143819477-143819499 ACAAGGCCTTTTGTGGAGAGGGG - Intronic
1050756615 9:9012058-9012080 GCAAGGTACCATGTTGTGAGAGG + Intronic
1052892906 9:33720249-33720271 GCAGGCCCCCTTGTGGTCAGAGG + Intergenic
1053647727 9:40132994-40133016 GCACAGCCCCTTGTGGGGATTGG + Intergenic
1053758004 9:41330849-41330871 GCACAGCCCCTTGTGGGGATTGG - Intergenic
1054536852 9:66243176-66243198 GCACAGCCCCTTGTGGGGATTGG - Intergenic
1056482538 9:87020139-87020161 GGAAGGCTCCTTTGGGTGAGAGG + Intergenic
1057271079 9:93651844-93651866 GCCTGGCCCCCTGTGGTGTGTGG + Intronic
1202795504 9_KI270719v1_random:116286-116308 GCACAGCCCCTTGTGGGGATTGG + Intergenic
1187551114 X:20306799-20306821 GCAAGACCCCTCGTGGTGTTTGG - Intergenic
1192080767 X:68045839-68045861 GCAAGGGACCTTGTGGTTTGTGG - Exonic
1192776877 X:74254672-74254694 GCAAGGCCCCTTTAAGGGAGGGG - Intergenic
1192849808 X:74942823-74942845 GCCAAGCCCCATCTGGTGAGGGG + Intergenic
1193380519 X:80810998-80811020 TCAAGGCCCACTGTGGTCAGTGG - Intergenic
1197902968 X:131393154-131393176 ACAAGGCCTCTTGAAGTGAGAGG - Intronic
1198183429 X:134232200-134232222 GCAAAGCCCCTAATGGTGGGAGG + Intergenic
1199593163 X:149486681-149486703 ACAAGGCTCCTTGTGGACAGGGG + Intronic