ID: 1152291582

View in Genome Browser
Species Human (GRCh38)
Location 17:79442908-79442930
Sequence GAAGCTCCCCACAGCCACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152291577_1152291582 25 Left 1152291577 17:79442860-79442882 CCGGGTAGAATCAGGTCCGTGCA 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1152291582 17:79442908-79442930 GAAGCTCCCCACAGCCACAATGG 0: 1
1: 1
2: 0
3: 18
4: 160
1152291578_1152291582 9 Left 1152291578 17:79442876-79442898 CCGTGCATGATTCCACTCCTTGC 0: 1
1: 0
2: 1
3: 14
4: 167
Right 1152291582 17:79442908-79442930 GAAGCTCCCCACAGCCACAATGG 0: 1
1: 1
2: 0
3: 18
4: 160
1152291576_1152291582 26 Left 1152291576 17:79442859-79442881 CCCGGGTAGAATCAGGTCCGTGC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1152291582 17:79442908-79442930 GAAGCTCCCCACAGCCACAATGG 0: 1
1: 1
2: 0
3: 18
4: 160
1152291580_1152291582 -3 Left 1152291580 17:79442888-79442910 CCACTCCTTGCTTCTGGTCTGAA 0: 1
1: 0
2: 6
3: 20
4: 331
Right 1152291582 17:79442908-79442930 GAAGCTCCCCACAGCCACAATGG 0: 1
1: 1
2: 0
3: 18
4: 160
1152291581_1152291582 -8 Left 1152291581 17:79442893-79442915 CCTTGCTTCTGGTCTGAAGCTCC 0: 1
1: 0
2: 2
3: 19
4: 272
Right 1152291582 17:79442908-79442930 GAAGCTCCCCACAGCCACAATGG 0: 1
1: 1
2: 0
3: 18
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152291582 Original CRISPR GAAGCTCCCCACAGCCACAA TGG Intronic
900094186 1:933731-933753 GAAGCCCCCCCCAGGCACATAGG - Intronic
900806068 1:4769178-4769200 GATGCTTCCCACAGTCCCAAAGG - Intronic
900999233 1:6139835-6139857 GAACCTCCCCTGAGCCACACTGG - Intronic
903540882 1:24095600-24095622 GAACTTTCCCAAAGCCACAAGGG - Intronic
905284731 1:36871848-36871870 GGAGGTACCCACAGCCACACAGG - Intronic
906873446 1:49510152-49510174 GAAGCTCCTGACTTCCACAATGG + Intronic
908765611 1:67552404-67552426 GAACCTGGCCACAGCCACACTGG - Intergenic
909189777 1:72537965-72537987 GCAGCTCCTCACAGACCCAACGG + Intergenic
911093831 1:94039718-94039740 GAAGCTCTCCCCAGACACTAAGG + Intronic
912366336 1:109136950-109136972 GGAGCTCCCCTCCTCCACAACGG - Intronic
912500823 1:110121014-110121036 CAATCTTCCCACAGCCACAGCGG + Intergenic
915956146 1:160221621-160221643 GAAGTTCCCCACAGCTAAGAAGG + Intronic
916965977 1:169944038-169944060 GAAGGTGCCGCCAGCCACAATGG - Intronic
923714343 1:236412122-236412144 GAAGCACCACACAGCTACACAGG - Intronic
924759733 1:246972371-246972393 AAAGCTCCCAGCAGCCAGAAAGG - Intronic
1062832595 10:615910-615932 GAGCCTCCCTACAGGCACAAAGG - Intronic
1063210890 10:3880371-3880393 GGAGCTCTCCACAGGAACAAGGG - Intergenic
1065491248 10:26283878-26283900 CCAGCTCCCCACAGCCTCAACGG - Intronic
1065815625 10:29480183-29480205 GAAGCAGCACACAGCCACATGGG + Intronic
1065957307 10:30705021-30705043 GAAGCAGCACACAGCCACATGGG - Intergenic
1066225729 10:33381346-33381368 GTTCCTCCCCACAGCCACAGAGG - Intergenic
1070739675 10:78894523-78894545 GAAGCTCTCCTCACCCTCAAAGG - Intergenic
1070805077 10:79266166-79266188 GAAGTTGCCCACAGTCACACAGG + Intronic
1072609931 10:97011247-97011269 GGAGATCCCCACAGCCTCAATGG - Intronic
1073184366 10:101606878-101606900 GAAGCTCCCGATAGGCTCAAGGG - Intronic
1074089029 10:110229353-110229375 GAAGCTCCCCAAAGCCTTCAGGG - Intronic
1074509796 10:114101636-114101658 GCAGCTCCCGACACCCACACAGG + Intergenic
1075256137 10:120927117-120927139 GGAGCTGCCCACAGCCTCCAGGG + Intergenic
1075275012 10:121085512-121085534 GAAGAAGGCCACAGCCACAATGG - Intergenic
1076250642 10:128981344-128981366 GAAGCTCCTCACAGCCACCTTGG - Intergenic
1078484155 11:11706286-11706308 GAGGCTCCCCACAAGCACATGGG + Intergenic
1078807803 11:14724048-14724070 GAGTCTCCCCATAGCCACTATGG - Intronic
1079074972 11:17379096-17379118 AAAGCTCCCCACTGCCAAGAGGG - Intergenic
1080606464 11:33869072-33869094 GACGCTCCCCAAAGCCACCACGG - Intronic
1081603309 11:44510633-44510655 GTGGCTCCACCCAGCCACAAGGG + Intergenic
1081656676 11:44862029-44862051 GAAACTCCCCTCAGCCATGAAGG - Intronic
1081907670 11:46679799-46679821 GAAGCTCGGCACAGCCTGAAGGG + Intronic
1083588294 11:63876490-63876512 AAAGAACCCCACAGCCATAACGG - Intronic
1084607148 11:70179062-70179084 GAGGCTCCCCTCAGCTACTAGGG + Intronic
1090329843 11:125922500-125922522 GAAGCTCACCATAGCGACAGTGG - Intronic
1090397652 11:126429743-126429765 GAAGCTGCCCACTGCCTCAGGGG - Intronic
1090996500 11:131870571-131870593 GAAGCTGCTCAGAGCTACAAAGG - Intronic
1091264806 11:134262244-134262266 GAAGCTGCCCACAGCCACCCTGG - Intronic
1091982936 12:4881230-4881252 GAAGACTCCCACAGCCTCAAAGG + Intergenic
1096484921 12:51973405-51973427 GAATGTCCCCACTGCCACAAAGG + Intronic
1100132137 12:91508744-91508766 GAAGCTCTACTCAGCTACAAAGG + Intergenic
1103051485 12:117783662-117783684 GAAACTCACCACCGCCATAATGG - Intronic
1103843779 12:123887260-123887282 GAAGCCCTCCTCAGCCACATGGG - Exonic
1104978178 12:132561353-132561375 CAAGCTCCCCAGGGCCACAAGGG - Intronic
1105701712 13:22939663-22939685 GAAGCTCCACAGAGCCCCCAAGG + Intergenic
1105854328 13:24361452-24361474 GAAGCTCCACAGAGCCCCCAAGG + Intergenic
1111232577 13:85363186-85363208 GAACCTGCGCAGAGCCACAAGGG - Intergenic
1114524522 14:23359599-23359621 GAAGCCCCCCACCCCCACACAGG - Exonic
1116085415 14:40231160-40231182 GAAGCTCTCAACAGCAAGAAGGG + Intergenic
1118446123 14:65852601-65852623 GCAGCTCCCCAGTGCCCCAATGG - Intergenic
1119557184 14:75562301-75562323 GTAACTCCCCACTGCCATAAAGG - Intergenic
1121116966 14:91350693-91350715 TCAGCTCCCCACAACCACAGAGG + Intronic
1123196199 14:106618812-106618834 GATGCTCCTCATAACCACAAAGG - Intergenic
1128412453 15:67413275-67413297 CAAGGTCCCAACAGCCACAATGG - Intronic
1128612544 15:69085456-69085478 AAGGCTCCCCAGAGCCACCAGGG + Intergenic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133337875 16:5017874-5017896 GAATTTCCCCTGAGCCACAAAGG + Exonic
1133396399 16:5450767-5450789 GAGGCTACCCAAAGTCACAAGGG - Intergenic
1133588869 16:7223116-7223138 GTAGCTCACCACATCTACAAGGG + Intronic
1136093633 16:27938134-27938156 GAAACTGACCACAGCCCCAAGGG - Intronic
1138553843 16:57760994-57761016 GAGGATCCCCACAACCCCAAGGG - Intronic
1139579591 16:67864549-67864571 GAATCTCCCCACATCCTCACTGG + Intronic
1141489641 16:84363459-84363481 GAATCTCCCCACACCCATCATGG - Intergenic
1141722793 16:85766146-85766168 AAAGCTTCCCACAGCCACGCGGG - Intergenic
1141837160 16:86549221-86549243 GAAGCTCCCCACCCCCAGAGGGG - Intronic
1142276463 16:89121353-89121375 GAATCTCCCCACACCTACTATGG - Intronic
1142720404 17:1772002-1772024 GAAGCTCGCCAGGTCCACAAAGG + Exonic
1143942088 17:10553062-10553084 TAAACTCCCCACTGCCACTATGG + Intergenic
1148210495 17:45805713-45805735 CCAGCTCCCCACAGCCAGAGGGG + Intronic
1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG + Intronic
1150967571 17:69989154-69989176 GAAGCTAACCTAAGCCACAATGG + Intergenic
1151285651 17:73109139-73109161 GAATCTCCCGACAGCCACGTAGG + Intergenic
1152263474 17:79279664-79279686 TCAGCTCCCCACAGCCAGCAAGG + Intronic
1152291582 17:79442908-79442930 GAAGCTCCCCACAGCCACAATGG + Intronic
1156404242 18:36769595-36769617 GCAGCTCCCCTCCTCCACAATGG - Intronic
1158425758 18:57338482-57338504 GAAGCTCCCCACAGCATCCCAGG - Intergenic
1160408599 18:78659800-78659822 GGAACTCCCCACAGCCACCCTGG + Intergenic
1161076722 19:2289520-2289542 AAAGGGCCCCACAGCCCCAAGGG - Intronic
1162335704 19:10058959-10058981 GAAGCATCCCACACCCACTAGGG - Intergenic
1163515477 19:17760615-17760637 AATGCTCCCCAAAGCCCCAAAGG - Intronic
1166644320 19:44519903-44519925 GAAGGTCCCAACAGCCATGATGG + Intronic
1168078371 19:53992470-53992492 GAAGCTCCCTGCAGCTCCAAGGG - Exonic
926559178 2:14396410-14396432 GAAGAGGCCCACAACCACAAAGG + Intergenic
930776001 2:55171078-55171100 GAGACCCCCCACAGCCACAGTGG + Intergenic
932614566 2:73223645-73223667 GAAGCTCCCCACAGGCACAAAGG - Intronic
934900422 2:98155408-98155430 AAAGCTCCCCACCGCCACACTGG - Intronic
936985162 2:118302208-118302230 AAAGCTCCCGACAGCCACCCAGG - Intergenic
937389588 2:121472773-121472795 GAAGCTCCAAACAGCCAAAGTGG + Intronic
942144284 2:173011066-173011088 GAAGAACCCCACAGCCTCTAGGG - Intronic
942588868 2:177518792-177518814 GAAACTCCCAATAGCCACACTGG - Intronic
943701155 2:190989342-190989364 GAAGCTCCCAACATCCACCAAGG + Intronic
946238939 2:218342131-218342153 GAAACTCACCACAGCCAGAGAGG - Exonic
947720702 2:232367860-232367882 GAAGCTCCCTCCAGCCAGACAGG + Intergenic
948240493 2:236429257-236429279 GCAGCTGACCCCAGCCACAAAGG - Intronic
948753647 2:240146323-240146345 GCAGCTCCCCACGCCCACGAGGG + Intergenic
948950546 2:241248395-241248417 GCAACTCCCCACTGACACAAGGG + Intronic
1169106143 20:2996248-2996270 GAAGGGCCCCAAAGCCACCAAGG - Intronic
1169754726 20:9031675-9031697 GAAAGTCCCCACAACCCCAAGGG - Intergenic
1171779437 20:29405821-29405843 GAAGCTCCCCAGGGCCAGTAGGG + Intergenic
1172806438 20:37615283-37615305 GAAGCTCCCCAGAGTTTCAAAGG - Intergenic
1177607191 21:23396023-23396045 GAGGCTGGCCACAGCCACAAAGG - Intergenic
1178181563 21:30167927-30167949 GAAGCCCCCCACTGCCTCTAGGG - Intergenic
1179282114 21:39942625-39942647 GAAGATTCACACAGACACAAAGG - Intergenic
1179447708 21:41444797-41444819 GAAGCCCGGCTCAGCCACAAGGG - Intronic
1179616008 21:42583883-42583905 GAATCTCCACACAGCCACGGTGG + Intergenic
1179989748 21:44941416-44941438 GAGGCTGCACACAGCCAGAAGGG - Intronic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1180836846 22:18934228-18934250 GAATCTCCCCACAGCCCAGAGGG + Intronic
1183228594 22:36566682-36566704 GGAGCTCCCCACTGCCTCCAGGG + Intronic
1183600247 22:38835761-38835783 GGACCTGCCCACAGCCACAGAGG - Intronic
1184348874 22:43930203-43930225 CAAGTTCCCCACAGCCACACAGG - Intronic
1184493769 22:44825634-44825656 GAAGCGCCCCACAGCTCCCAGGG - Intronic
1203286939 22_KI270734v1_random:159527-159549 GAATCTCCCCACAGCCCAGAGGG + Intergenic
950530572 3:13550250-13550272 CATGCTCCCCACAGCCACCCAGG - Intronic
954860680 3:53688161-53688183 GAAGCTTCCAACAGCCCCACAGG - Intronic
956928718 3:74018199-74018221 TAAGCTGCCCACAGCCACTCTGG + Intergenic
959427080 3:106204520-106204542 GAAGCTTCCCCCATCCACTATGG + Intergenic
961623715 3:128244443-128244465 GGAGCCTCCCACAGCCACATTGG + Intronic
961817725 3:129559845-129559867 CAAGCTCCGCAGAGCCACCAAGG - Intronic
961873499 3:130004102-130004124 GAAGCTCCACACTGACACTAAGG - Intergenic
962835399 3:139184859-139184881 GAAGCTCTCCTCTGCCACAATGG - Intronic
966660818 3:182412369-182412391 GATGCTCCTCACAACCACACTGG + Intergenic
968291363 3:197542219-197542241 TGGGCTCCCCAAAGCCACAATGG + Intronic
968602605 4:1517405-1517427 GTCGCTCCCCAGAGCCACCATGG - Intergenic
969493565 4:7513368-7513390 GAAGCTCCCCAGAGGGAAAACGG + Intronic
970156118 4:13143345-13143367 GCAGCGCCCCACAGCCACCGAGG - Intergenic
970696581 4:18685297-18685319 GAAGCTGCCCAAAGGCACTATGG + Intergenic
971192551 4:24441370-24441392 GCAGCACCCCACGGGCACAAGGG - Intergenic
981187086 4:141816276-141816298 GAAGCACACCACCTCCACAAAGG + Intergenic
981820854 4:148886074-148886096 GAAGCTCCCCAGAGGAATAAAGG + Intergenic
982361010 4:154519076-154519098 GCAGCTCTCTACAGCCACCATGG - Intergenic
985745254 5:1643059-1643081 CAAGCTCCACACAGGCACAAGGG - Intergenic
989271802 5:39542059-39542081 GAAGCTACCCAAAGCCCCACTGG - Intergenic
991630160 5:68648665-68648687 GAAGAAGCCCACAGCCACATGGG + Intergenic
995480040 5:112584321-112584343 GCAGCTCTCCACAGACCCAATGG - Intergenic
997614550 5:135237440-135237462 GAAGATCCCCACAGCCAGGGAGG + Intronic
998513863 5:142735673-142735695 GAAGGTCCCAACAGCCAAATGGG + Intergenic
998764660 5:145472324-145472346 GATGCTCTCCACAGCCCCATAGG + Intronic
999495556 5:152093206-152093228 GAAGATCTCAACAGGCACAAAGG - Intergenic
1001241999 5:170078195-170078217 GAAGCTCCTCCCAACCACGATGG + Intronic
1007089907 6:39177210-39177232 GAACTTCTCCACAGCCATAAAGG + Intergenic
1013359341 6:109379936-109379958 GAAGACACCCACAGCCACTAAGG + Intronic
1015470480 6:133599892-133599914 GAAGATTCCCTCAGCCACACTGG + Intergenic
1015884436 6:137901871-137901893 GAAGCTCACCCCAGACGCAATGG + Intergenic
1016505965 6:144779247-144779269 ACAGCTCCCCACAGACACCAAGG - Intronic
1017085751 6:150711251-150711273 TATGCGCCCCACAGCCACAAGGG + Intronic
1017892792 6:158653181-158653203 GAAGCTGATTACAGCCACAAAGG - Intronic
1018501254 6:164413168-164413190 AGAGATCCCCACAGCCACCAAGG - Intergenic
1018648922 6:165974773-165974795 CAAGTTCCCTACAGCCAGAAAGG + Intronic
1026957260 7:74385582-74385604 GGTGCTCCTCACAGCCATAAAGG - Intronic
1027261529 7:76468138-76468160 GGTGCTCCCCAGAGCCACACCGG - Intronic
1028716926 7:93981572-93981594 TAAGCTGTCCACAGCCTCAAAGG + Intronic
1031936198 7:127738154-127738176 GAAGCTGCCCACAGTGAGAAAGG - Intronic
1033248388 7:139737642-139737664 GAAGCTCCCCAGTGCCCCATTGG + Intronic
1034460355 7:151194618-151194640 GAAGACCCCCACCACCACAAGGG + Intronic
1035445067 7:158935663-158935685 CAGGCTCCCAACAGCCACAGGGG - Intronic
1037807737 8:22067716-22067738 GAGGCCCCCCCCAGCCACACTGG + Intronic
1039580280 8:38660393-38660415 GAAGCTGCCCACAGACATTATGG + Intergenic
1040310145 8:46232642-46232664 GAAGGCCCTCACAGCCAAAACGG + Intergenic
1046259007 8:111741356-111741378 CAGGCTCCTCCCAGCCACAAAGG - Intergenic
1048735494 8:137495501-137495523 GAAGATCCATACAGACACAAAGG + Intergenic
1048900260 8:139030644-139030666 GAATTCCCCCACAGCCCCAAAGG - Intergenic
1053547550 9:39039313-39039335 GAAGCTCCCCAGTGCCAAAAAGG - Intergenic
1053811654 9:41858978-41859000 GAAGCTCCCCAGTGCCAAAAAGG - Intergenic
1054618940 9:67328461-67328483 GAAGCTCCCCAGTGCCAAAAAGG + Intergenic
1057447425 9:95127224-95127246 GAAGCTCCCCCCAGCTCCCAGGG - Intronic
1058529045 9:105887922-105887944 GACTCTCCCCACAGCCCCCAAGG - Intergenic
1060961834 9:127686281-127686303 GTATCTTCCCACAGCCACACAGG - Intronic
1061404131 9:130384352-130384374 GACTATCCCCACAGCCACCACGG - Intronic
1061544822 9:131298574-131298596 AAAGCAGCCCAAAGCCACAAAGG + Intronic
1061743601 9:132724284-132724306 CAAGCTTCCCACAGCCCCAGAGG + Intergenic
1185642159 X:1594311-1594333 GGAGGTCCCCACAGCCTCAGGGG - Intronic
1187122733 X:16424851-16424873 GTGGCTCCCCAGAGGCACAATGG - Intergenic
1197807591 X:130412545-130412567 GAAGCTCCCCAAATCCAGGACGG + Exonic
1199526388 X:148796622-148796644 GAACCAACCCACAGCCTCAAAGG - Intronic