ID: 1152292068

View in Genome Browser
Species Human (GRCh38)
Location 17:79445679-79445701
Sequence GGCTTTGGAATGCCCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152292068_1152292081 29 Left 1152292068 17:79445679-79445701 CCAAGATGGGGCATTCCAAAGCC 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1152292081 17:79445731-79445753 GTCACAAGAAGCTGCTCGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
1152292068_1152292080 25 Left 1152292068 17:79445679-79445701 CCAAGATGGGGCATTCCAAAGCC 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1152292080 17:79445727-79445749 CAGAGTCACAAGAAGCTGCTCGG 0: 1
1: 0
2: 0
3: 22
4: 206
1152292068_1152292082 30 Left 1152292068 17:79445679-79445701 CCAAGATGGGGCATTCCAAAGCC 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1152292082 17:79445732-79445754 TCACAAGAAGCTGCTCGGCTGGG 0: 1
1: 0
2: 1
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152292068 Original CRISPR GGCTTTGGAATGCCCCATCT TGG (reversed) Intronic
900737329 1:4307350-4307372 GGGCTTGGAATCCCCCATGTTGG - Intergenic
902504062 1:16928140-16928162 GGCTTTTGAATGCCCTGCCTGGG + Intronic
907063088 1:51450704-51450726 GGCTCTGCAATCCCACATCTGGG + Intronic
907735965 1:57112408-57112430 GGAATTGGACTGCCCCATCTTGG - Intronic
909499779 1:76321159-76321181 GGCTTCAGAATGGCTCATCTTGG - Intronic
915582502 1:156823336-156823358 GGCTCAGGAAGGCACCATCTGGG - Intronic
915744060 1:158142561-158142583 GGCATTGGCATGCACCAGCTAGG + Intergenic
919777623 1:201204567-201204589 GGCTTTCCAAAGCCCCATCTGGG - Intronic
920044991 1:203127399-203127421 GACTTCAGAATGCCCCCTCTGGG - Exonic
922597006 1:226821779-226821801 GGCTTCAGAAGGGCCCATCTAGG - Intergenic
923419255 1:233796484-233796506 GGCCTTGCCATGCACCATCTTGG - Intergenic
923726787 1:236512719-236512741 AGCTTTGCAATGGCCCATGTTGG + Intergenic
924455814 1:244218196-244218218 GGCTTTGGAATCCGTCCTCTCGG + Intergenic
1066028224 10:31387322-31387344 GGTTTTGGAATGCTCCATTGAGG + Intronic
1066209924 10:33226534-33226556 AGCTTTGGAATGCCCTTGCTGGG - Intronic
1067523885 10:47027018-47027040 GGCTCTGGCATGCCTCACCTTGG - Intergenic
1067830163 10:49607168-49607190 GGCTTTGCCAGGTCCCATCTCGG + Intergenic
1070348482 10:75568692-75568714 GGCATCTGAATGCCCCAGCTGGG + Intronic
1077444142 11:2582470-2582492 GGCCCAGGAATGCCCCAGCTGGG - Intronic
1078956128 11:16197140-16197162 GGCTTTTTAGTGCCCCATTTTGG + Intronic
1080854010 11:36095964-36095986 GGTTTTGGATTTCTCCATCTCGG + Intronic
1085810188 11:79672925-79672947 GGCTTTGGAATGAATCATCCTGG + Intergenic
1088242978 11:107789960-107789982 GGGTGTGGCCTGCCCCATCTTGG + Intergenic
1090186582 11:124743026-124743048 GGCTTTGGAAAGCACCAGCCAGG + Intronic
1090582624 11:128176786-128176808 GGCTTGGGAATGACTGATCTAGG + Intergenic
1091330086 11:134725307-134725329 GGCTTTGGCAGCCCCCATCCGGG - Intergenic
1094834929 12:34317859-34317881 TGCTTTGGGATGCCCCCACTTGG + Intergenic
1094835682 12:34320995-34321017 CGCTTTGGGGTGCCCCATGTGGG + Intergenic
1103552057 12:121744913-121744935 GGCTTTGGAAAAACACATCTTGG + Intronic
1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG + Intronic
1104323337 12:127772740-127772762 GGATGTGGAATGGCACATCTGGG + Intergenic
1110155110 13:72307124-72307146 GGCTCTGGATTGCCAGATCTAGG + Intergenic
1113429620 13:110238302-110238324 GGCTTGGGAATGTCCCTTTTTGG + Intronic
1114231635 14:20788277-20788299 GGCTTAGCAATTCCACATCTGGG - Intergenic
1114588716 14:23839567-23839589 GCCCTTGGAATGTCCCACCTGGG + Intergenic
1114810734 14:25895814-25895836 TGCGTTAGAATGACCCATCTTGG - Intergenic
1117344873 14:54822064-54822086 AGCTTTGGAATGGGCCATCCTGG - Intergenic
1122904062 14:104793933-104793955 GGCTGTGGAAAGACCCATGTTGG - Exonic
1124410070 15:29429785-29429807 GGCTGTGCAATGCCCGATCCGGG + Intronic
1124903443 15:33845999-33846021 GGCATGGGAATGTGCCATCTTGG - Intronic
1126788427 15:52198369-52198391 GGATTAGCAATGCCCCATGTGGG + Intronic
1127681095 15:61299179-61299201 TGCTTGGGAAAGGCCCATCTGGG + Intergenic
1132551872 16:556924-556946 GGCTCTGGAAGACCCCAGCTGGG - Intergenic
1136700623 16:32136868-32136890 GGTTTTGGAATGCTGCAGCTGGG + Intergenic
1136767035 16:32790597-32790619 GGTTTTGGAATGCTGCAGCTGGG - Intergenic
1136801114 16:33080104-33080126 GGTTTTGGAATGCTGCAGCTGGG + Intergenic
1203069430 16_KI270728v1_random:1052843-1052865 GGTTTTGGAATGCTGCAGCTGGG - Intergenic
1203124785 16_KI270728v1_random:1564138-1564160 GGTTTTGGAATGCTGCAGCTGGG - Intergenic
1147458404 17:40553020-40553042 GGCATGGCAAGGCCCCATCTCGG + Intergenic
1149516888 17:57287648-57287670 GGCTTTCCAATGCCCCACGTAGG - Intronic
1151057505 17:71050302-71050324 GGCTTTGGAATGCAACCTATGGG - Intergenic
1151183608 17:72347646-72347668 GGCTTTGGAATCAGCCATCTGGG + Intergenic
1152292068 17:79445679-79445701 GGCTTTGGAATGCCCCATCTTGG - Intronic
1152754734 17:82082492-82082514 GGCTTTTGAGGGCCCCATTTGGG + Intronic
1154032791 18:10767856-10767878 GGCTGTGGGATGCCCCACCGTGG + Intronic
1158306171 18:56108204-56108226 GGCTTGAGAATGCCCCAGCCTGG - Intergenic
1158341123 18:56467697-56467719 GGCTTTGGAATTCCAGTTCTTGG - Intergenic
1161858309 19:6778476-6778498 GGCTTTGGAGAGCCACACCTGGG + Intronic
1166967452 19:46538113-46538135 GGCATGTGAGTGCCCCATCTTGG + Intronic
925286216 2:2717242-2717264 GGCTGTGGACTCCCCCTTCTTGG - Intergenic
927107453 2:19840341-19840363 GGTTTTGAAAGGCCCCTTCTTGG - Intergenic
928177713 2:29046399-29046421 GCCTTGGGAAGGTCCCATCTAGG + Intronic
929115561 2:38441169-38441191 TGCTTTGGAGGGCCCCATTTTGG - Intergenic
936806761 2:116342657-116342679 GGCTTATGAATGCTCCTTCTTGG - Intergenic
939104478 2:137933215-137933237 GTCTTTGGTATTCCCCAGCTTGG + Intergenic
939445978 2:142310521-142310543 AGCTTTGGAAGCCCCCACCTAGG - Intergenic
1171070253 20:22061741-22061763 TGCTGAGGAATGCCACATCTGGG + Intergenic
1172884973 20:38224820-38224842 GGGTATGAAATGCCCCCTCTTGG + Intronic
1176268984 20:64225653-64225675 TGCTTCTGAGTGCCCCATCTGGG - Intronic
1181828633 22:25540565-25540587 GGCTCTGGAATTCCACCTCTGGG + Intergenic
1183011600 22:34951231-34951253 GGCTTTGGAATTCAGCATCTGGG + Intergenic
1183480596 22:38062618-38062640 CTCTTTGGATTCCCCCATCTTGG + Intronic
1185279718 22:49964846-49964868 GGCTGTGGGGTGCCCCATGTTGG + Intergenic
950471089 3:13186855-13186877 GGCTGTGGGATGCCTCCTCTGGG - Intergenic
951587628 3:24231780-24231802 GGCTGTGGAAAGGACCATCTTGG - Intronic
951704933 3:25534907-25534929 GGCTTCAGAATGACACATCTGGG - Intronic
952482003 3:33771239-33771261 GACTTTGAGATGCCCCATGTAGG - Intergenic
952621902 3:35354531-35354553 GGAATGGGAATGCCCCATTTGGG + Intergenic
959483120 3:106897464-106897486 GGCCTTGGAATGGGCCTTCTCGG + Intergenic
963218688 3:142781095-142781117 GGCTTTGGAGTAACTCATCTGGG + Intronic
964740038 3:159955422-159955444 GGGTTTTGAAGGACCCATCTAGG - Intergenic
964990203 3:162801441-162801463 AGCTTTAGAATGCTCTATCTAGG + Intergenic
967578969 3:191129414-191129436 GGCATTTGAATGCCAAATCTTGG - Intergenic
968511593 4:998031-998053 GACTTTGGAATGCACCTTCTGGG + Intronic
986082210 5:4406795-4406817 GGCTTTAGAATGCCCTCACTAGG + Intergenic
986815374 5:11404230-11404252 GGCTTTGAAAGTCCCCATCAGGG + Intronic
991550769 5:67833567-67833589 GGCTTTGGAATGCCTCATGTAGG + Intergenic
993189652 5:84665950-84665972 GGATTTGGATTGCACCATTTGGG - Intergenic
995346636 5:111127873-111127895 GGCTTTGAAATACCCATTCTTGG - Exonic
995365719 5:111357930-111357952 GGCTTTTGAATTCCAAATCTGGG + Intronic
997061835 5:130515025-130515047 GGCTTTGCAATTCACAATCTTGG + Intergenic
998160374 5:139809629-139809651 GGCCATGGAAGGCCACATCTGGG - Exonic
1001966545 5:175913877-175913899 AGCCTTTGAATGCCACATCTGGG - Intergenic
1002250402 5:177925327-177925349 AGCCTTTGAATGCCACATCTGGG + Intergenic
1005025571 6:21459913-21459935 GCCTGTGGAATGCACCCTCTTGG - Intergenic
1006120054 6:31798637-31798659 GGCTTAGGAATGCCCCCTTTTGG - Intronic
1013080516 6:106808082-106808104 GGCTGTGGAGTGTCCCATCTTGG + Intergenic
1017063751 6:150509593-150509615 GGCTTTGGAAGCACCCATCTAGG - Intergenic
1017367966 6:153667507-153667529 GGCCTTGGAATGTGCCTTCTTGG - Intergenic
1018085586 6:160298507-160298529 GTCTTTGGAATGCCCACTGTGGG - Intergenic
1023140072 7:37092841-37092863 GGCATCTGAATGACCCATCTTGG - Intronic
1023863759 7:44229311-44229333 GGCTCTGGAGTGGCCCCTCTAGG + Intronic
1024507108 7:50171276-50171298 GGTTTTGTGATGCACCATCTTGG + Intergenic
1030351821 7:108498182-108498204 GGTTTTGGAATGCCATACCTTGG + Intronic
1031659018 7:124397408-124397430 GACTTTAGAATGCCCCAAGTAGG - Intergenic
1033274760 7:139963235-139963257 GGGTTTGGAAAGGCCCAGCTTGG - Intronic
1034199622 7:149275762-149275784 GGCCTAGGACTGCCCCAACTAGG + Intronic
1036501694 8:9319999-9320021 GGCCTTGGAATTCCCCGTCCAGG - Intergenic
1039830325 8:41208410-41208432 GGCTTTCGAATTCCACATCTTGG - Intergenic
1049345140 8:142134753-142134775 GGAGGGGGAATGCCCCATCTAGG - Intergenic
1049462617 8:142737130-142737152 GGCTTTGGACAGCACCTTCTTGG - Intergenic
1053159740 9:35805776-35805798 GGCTTGGGGGTGCCCCATTTCGG + Intronic
1053467646 9:38321697-38321719 GGCTCTAAACTGCCCCATCTGGG - Intergenic
1061064982 9:128272162-128272184 GGCTTTTGAATGCCCAGTGTGGG - Intronic
1061201864 9:129142702-129142724 GGCCTCGGAATCTCCCATCTGGG + Intronic
1189133065 X:38520349-38520371 GGCTTTGGAATGTGTCAACTTGG - Intronic
1189451381 X:41135178-41135200 GTATATGAAATGCCCCATCTTGG - Intronic
1192129963 X:68540523-68540545 GGCCTCTGAATGGCCCATCTTGG - Intergenic
1192403119 X:70857098-70857120 GGGTTGGGCAGGCCCCATCTGGG + Intronic
1195965742 X:110428611-110428633 GGTTTTAGAAAGCCACATCTTGG - Intronic
1202199560 Y:22331859-22331881 GGCTTTGGGATGCACTGTCTGGG - Intronic