ID: 1152292427

View in Genome Browser
Species Human (GRCh38)
Location 17:79447729-79447751
Sequence CTGAGCAATGCTCACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 166}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152292427_1152292439 30 Left 1152292427 17:79447729-79447751 CCATCCATGTGAGCATTGCTCAG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1152292439 17:79447782-79447804 GGCCAGGGTGAGCCCCAAAATGG 0: 1
1: 0
2: 1
3: 13
4: 157
1152292427_1152292430 -8 Left 1152292427 17:79447729-79447751 CCATCCATGTGAGCATTGCTCAG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1152292430 17:79447744-79447766 TTGCTCAGCAGAGCAGGCTGTGG 0: 1
1: 0
2: 2
3: 34
4: 421
1152292427_1152292434 6 Left 1152292427 17:79447729-79447751 CCATCCATGTGAGCATTGCTCAG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1152292434 17:79447758-79447780 AGGCTGTGGGCCGTGCTGAGGGG 0: 1
1: 0
2: 4
3: 27
4: 294
1152292427_1152292432 4 Left 1152292427 17:79447729-79447751 CCATCCATGTGAGCATTGCTCAG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1152292432 17:79447756-79447778 GCAGGCTGTGGGCCGTGCTGAGG 0: 1
1: 0
2: 1
3: 41
4: 364
1152292427_1152292435 9 Left 1152292427 17:79447729-79447751 CCATCCATGTGAGCATTGCTCAG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1152292435 17:79447761-79447783 CTGTGGGCCGTGCTGAGGGGCGG 0: 1
1: 0
2: 3
3: 23
4: 371
1152292427_1152292437 15 Left 1152292427 17:79447729-79447751 CCATCCATGTGAGCATTGCTCAG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1152292437 17:79447767-79447789 GCCGTGCTGAGGGGCGGCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 205
1152292427_1152292436 14 Left 1152292427 17:79447729-79447751 CCATCCATGTGAGCATTGCTCAG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1152292436 17:79447766-79447788 GGCCGTGCTGAGGGGCGGCCAGG 0: 1
1: 0
2: 3
3: 36
4: 326
1152292427_1152292431 -7 Left 1152292427 17:79447729-79447751 CCATCCATGTGAGCATTGCTCAG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1152292431 17:79447745-79447767 TGCTCAGCAGAGCAGGCTGTGGG 0: 1
1: 1
2: 2
3: 39
4: 324
1152292427_1152292433 5 Left 1152292427 17:79447729-79447751 CCATCCATGTGAGCATTGCTCAG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1152292433 17:79447757-79447779 CAGGCTGTGGGCCGTGCTGAGGG 0: 1
1: 0
2: 2
3: 24
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152292427 Original CRISPR CTGAGCAATGCTCACATGGA TGG (reversed) Intronic
902447507 1:16476432-16476454 CTGAGCAAGGCTCTCGTTGAGGG + Intergenic
902467362 1:16626386-16626408 CTGAGCAAGGCTCTCGTTGAGGG + Intergenic
902507219 1:16946350-16946372 CTGAGCAAGGCTCTCGTTGAGGG - Exonic
903057238 1:20644736-20644758 CTGATCAAGGTGCACATGGAGGG - Intronic
906167129 1:43694788-43694810 CTGGGCGCAGCTCACATGGAAGG - Exonic
906791136 1:48659638-48659660 CTGAGCTCTGCTCACCTGGAGGG - Intronic
907497002 1:54851873-54851895 TTGAGCACTGGTCACATTGAAGG - Exonic
907676634 1:56523788-56523810 CTGAGCACTGCTCAAATCAAAGG + Intronic
911475286 1:98366371-98366393 ATGAGCAATACTCAGGTGGAAGG - Intergenic
912851868 1:113133290-113133312 CTGGCCAATGCTCTCAGGGATGG - Intergenic
912851934 1:113134194-113134216 CTGGCCAATGCTCTCAGGGATGG + Intergenic
913115710 1:115694759-115694781 CAGAGAAATGCTCACATATATGG - Exonic
915350072 1:155218718-155218740 TTGAGCAAGGCACAGATGGAGGG - Intergenic
915353470 1:155240956-155240978 TTGAGCAAGGCACAGATGGAGGG - Intronic
920791448 1:209096815-209096837 CTGAGCAGTACTCAGATGGACGG - Intergenic
921032694 1:211347588-211347610 CTGGGAAATACACACATGGATGG + Intronic
921910229 1:220540510-220540532 CTGAGGAATGCTCAGATAGCTGG - Intronic
923034455 1:230274867-230274889 ATGATTAATGTTCACATGGATGG + Intronic
923122559 1:231006437-231006459 CTCAGCAAAGCTGACATAGAAGG + Intergenic
1064090023 10:12375388-12375410 GTGAGCAATCCTCACACGGAAGG - Intronic
1070873230 10:79776863-79776885 CTGACCACTGCCCACATGGTTGG + Intergenic
1071640155 10:87299013-87299035 CTGACCACTGCCCACATGGTTGG + Intergenic
1071655077 10:87438932-87438954 CTGACCACTGCCCACATGGTTGG - Intergenic
1073093156 10:100961636-100961658 CTCACCACTGCACACATGGAGGG - Intronic
1073495244 10:103884963-103884985 CTCAGCAATGCACACATAGTAGG - Intronic
1075239329 10:120763950-120763972 CTGAGCAACCCTGAAATGGAAGG + Intergenic
1076691908 10:132228114-132228136 CTGCACAATGCACACCTGGAGGG + Exonic
1077359443 11:2134215-2134237 CACAGCAATGCTCAGCTGGAAGG + Intronic
1079051161 11:17160973-17160995 GTGAGCAGTTCACACATGGATGG + Intronic
1079247759 11:18765586-18765608 CTGCTCTAGGCTCACATGGAGGG - Intronic
1079469473 11:20764700-20764722 CTGAGAACTGCTCAGCTGGAGGG + Intronic
1085101955 11:73808473-73808495 CTATTCCATGCTCACATGGAGGG - Intronic
1085310306 11:75512518-75512540 CTGAACAATGGCAACATGGACGG - Intronic
1086329006 11:85734390-85734412 CTCAGAAATTCTCTCATGGATGG + Exonic
1089121462 11:116138604-116138626 CTGAGCATTGCACACTTGAATGG - Intergenic
1089374254 11:117983359-117983381 GTGCCCAATGCCCACATGGAGGG - Intergenic
1089528932 11:119114072-119114094 CTGAGCAATGGGCACCTGGCAGG - Exonic
1090227116 11:125078340-125078362 CTCAGAAATGCTCATCTGGATGG - Intronic
1090668019 11:128927756-128927778 CTGAGCAAGGATCCCACGGAAGG + Intergenic
1100234128 12:92640971-92640993 CAGAGCAGTGGTCACAGGGAGGG + Intergenic
1101834599 12:108286536-108286558 GGGAGCAATGCTCACAGTGACGG - Intergenic
1104550017 12:129748082-129748104 ATGAGCATTGCTCAGATGCATGG + Intronic
1104897588 12:132171905-132171927 CTGAGCAAGCCTGAGATGGAGGG - Intergenic
1105495742 13:20929384-20929406 CTGAAAAATGTTCACATAGAAGG + Intergenic
1111571007 13:90086519-90086541 CTAAGGAATGCCCACATAGAAGG + Intergenic
1112450390 13:99502185-99502207 CTGAGTGTTGCTCACATGTAGGG - Intronic
1113520562 13:110937635-110937657 CTGAGCATTCCTCACAGGGAAGG - Intergenic
1114737104 14:25053111-25053133 GTGATTAATGTTCACATGGAGGG - Intergenic
1119286907 14:73462476-73462498 CTGGGCAAAGCTGACAAGGAAGG + Intronic
1119974933 14:79015026-79015048 CTGAGCAAATCTCAGAGGGAAGG - Intronic
1121870747 14:97404641-97404663 GTGAGAAATGCTCACAGGGGAGG - Intergenic
1122782908 14:104151111-104151133 CAGAGCAAAGCTCACTGGGAGGG - Intronic
1126197759 15:45950791-45950813 GTGAACAATGGTCACAGGGAGGG - Intergenic
1126696922 15:51334193-51334215 CTGAGGAATGCTCAAAATGATGG - Intronic
1131439206 15:92446111-92446133 CTGAGAAGGGCTCACCTGGATGG + Intronic
1132201472 15:99957189-99957211 CGGAGCAGTGCCCACAGGGATGG + Intergenic
1132798253 16:1736858-1736880 CTCACGGATGCTCACATGGACGG - Intronic
1132798498 16:1739400-1739422 CACAGGGATGCTCACATGGACGG - Intronic
1137827918 16:51515764-51515786 CTGAGGGATGCTCCCATGGATGG - Intergenic
1138057031 16:53845964-53845986 CAAAGCAATGTTCACATGGAAGG - Intronic
1138416177 16:56872615-56872637 ATGAGTAAGGCTCACCTGGAGGG - Intronic
1139444266 16:66987191-66987213 CTGAGGAAGGGTCACAAGGATGG + Intergenic
1140639629 16:76957097-76957119 CTGGGAAATGTGCACATGGAGGG + Intergenic
1142487794 17:258100-258122 CTGAGCAATGTTCCCCTGTACGG + Intronic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1144001570 17:11059998-11060020 GTGTGCAATGCTCCCCTGGAAGG - Intergenic
1146015497 17:29229981-29230003 CTGAGCAAGACTGACATTGATGG + Intergenic
1148825763 17:50392745-50392767 CTGAGCAAAGCTGACAGGCAAGG + Exonic
1151201990 17:72475534-72475556 CCGAGCTTTGCTCACATAGAGGG + Intergenic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1152476731 17:80523209-80523231 CAGAGCACTGCTCATATGCATGG + Intergenic
1152524726 17:80881448-80881470 GTGAGCTAAGCTCACATGAACGG + Intronic
1153926601 18:9840083-9840105 CTGAGTAATGCTGACATTGATGG + Intronic
1154959371 18:21292659-21292681 CTGATACATGCTTACATGGACGG - Intronic
1155662428 18:28265572-28265594 CCAAGCAATGAACACATGGAGGG - Intergenic
1156550612 18:38012423-38012445 CTGAGCAAAGGCCACATGGACGG + Intergenic
1160750392 19:731316-731338 CTCAGCTACGCTGACATGGAAGG - Intronic
1162068881 19:8142000-8142022 CAGGGCAAAGTTCACATGGAAGG + Exonic
1164730593 19:30501235-30501257 CTGAGGGATGTTCTCATGGAGGG - Intronic
1164918955 19:32074262-32074284 CTGGGCCAGCCTCACATGGAGGG - Intergenic
925310626 2:2879097-2879119 CTCAGTCATGCTCACAGGGAGGG - Intergenic
929044263 2:37775145-37775167 CTGAGCTATGGTGACAGGGATGG + Intergenic
929810872 2:45188371-45188393 CTGAGGAATGCCCACATCTAGGG - Intergenic
930754699 2:54962595-54962617 CTGATTGATGGTCACATGGAAGG + Exonic
931209176 2:60176486-60176508 CTGAGCAGAGCACACATGGGGGG + Intergenic
932080434 2:68709544-68709566 CTGAGCTTTGTACACATGGAGGG - Intronic
932396013 2:71448575-71448597 CTGAGTAATACACACATAGAAGG - Intergenic
932751716 2:74375535-74375557 CTGAGCAATGCCCAAATCCAGGG - Intronic
935585991 2:104800864-104800886 CTGAACACTGCTGAGATGGAGGG - Intergenic
936574825 2:113644197-113644219 CTGAGCAATGTACACATGGGTGG - Intergenic
941586754 2:167368895-167368917 CTTAGGAATACTCACATGGGGGG - Intergenic
943330679 2:186555318-186555340 CTGAGCATATCTCACATAGATGG + Intergenic
943335233 2:186605388-186605410 CTGAGCAATTCTCAAAATGATGG - Intronic
944613087 2:201431061-201431083 CTGAGTAATCTTCACATAGAAGG + Intronic
945246756 2:207724853-207724875 CTGAGCAAATCTCAAACGGATGG + Exonic
947729021 2:232418014-232418036 CTGGGCCATACTCACATGGGGGG + Intergenic
948384165 2:237571359-237571381 CTCACCTATGCTCACCTGGAAGG + Intergenic
1169983876 20:11420455-11420477 CTGAACAATGGGCACAGGGAGGG - Intergenic
1171279551 20:23884179-23884201 CTGAGCAATGCAGACCTGGCAGG - Intergenic
1171295148 20:24010969-24010991 CAGAGCAATGCACACCTGCATGG + Intergenic
1173832774 20:46102584-46102606 CAGAGCTATGCTGACATGGTAGG - Intergenic
1175578350 20:60079482-60079504 CTGGGCAGAGCTCACACGGAGGG - Intergenic
1176047134 20:63098567-63098589 GTGAGCAATGGACAGATGGATGG + Intergenic
1176066408 20:63198839-63198861 CTAAGCAATGCTCACAGTGTGGG + Intronic
1179335909 21:40453595-40453617 CTAAGCAATGCTCAGATGGATGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181665327 22:24391584-24391606 CTGAAAAATGCTCACAGTGAGGG - Intronic
1184189605 22:42885948-42885970 CTGAGCTAGGCTCCCATGCAGGG - Intronic
1185093071 22:48786696-48786718 CTCAGCAAGGCTTACATGCAAGG + Intronic
1185425348 22:50766679-50766701 CTGAGCAATGTACACATGGGTGG + Intergenic
1203296377 22_KI270736v1_random:46532-46554 CTGAGCTATGGTGACAGGGATGG + Intergenic
949603667 3:5631072-5631094 CTGAGAAATTATCAGATGGAGGG + Intergenic
949798629 3:7878549-7878571 CTGAGAAATGCTCAGATAGCAGG + Intergenic
950199093 3:11030133-11030155 ATGAGAAATGCTCACATAGCTGG + Intronic
953347848 3:42190807-42190829 CAGAGCAAGACTCCCATGGAGGG - Intronic
953478080 3:43222895-43222917 CTGAGCAAAACACACATGGAGGG + Intergenic
955614082 3:60787322-60787344 TTGAGCAGTGCTCAGAAGGATGG - Intronic
956190221 3:66600998-66601020 CTCAGCACTGTTAACATGGAGGG - Intergenic
957439213 3:80221338-80221360 TTCAGCAATGCTCTCTTGGAAGG - Intergenic
958880630 3:99665104-99665126 CTGAGAAATGGCAACATGGAAGG - Intronic
960706790 3:120490002-120490024 CTGAGCAATGCGGGCATAGAAGG + Intergenic
961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG + Intronic
963088688 3:141462187-141462209 CTGGTAAATGCTCACATGGAGGG + Intergenic
966505261 3:180693562-180693584 TTGTGCTGTGCTCACATGGATGG - Intronic
966766576 3:183468636-183468658 TAGAGTAATGCACACATGGATGG + Intergenic
969253652 4:5988342-5988364 CTGAGCAATGGCCCCATGGTAGG - Exonic
969948043 4:10805072-10805094 CTAAGGAATGCTCAGATGGCTGG + Intergenic
970407380 4:15777039-15777061 CTGAACAATGAACACAGGGAGGG + Intergenic
971029925 4:22624822-22624844 CTGAGCAATCTTCTCATGGGTGG + Intergenic
971037755 4:22713631-22713653 CTTAGCAATGCTCTGATGGATGG + Intergenic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
972446516 4:39149506-39149528 CTGAACAATGGACACAGGGAGGG + Intergenic
975498461 4:75058823-75058845 CTGAGCAATGCTCAGGCAGAAGG + Intergenic
976904979 4:90226216-90226238 CTGAGCAAGGCTCAGCTGGCTGG - Intronic
978578698 4:110211476-110211498 CTGGGCAATGCGCATATGAAGGG + Intergenic
981057466 4:140379171-140379193 ATGATGAATGCTGACATGGATGG + Exonic
986310741 5:6549242-6549264 CTGAGCAATACTCACAGCGGAGG + Intergenic
988319556 5:29675653-29675675 CTGGGCAATGATCACATGAAAGG - Intergenic
990483196 5:56231267-56231289 CTGTGAATTGCTCACATGAAAGG + Intronic
990799355 5:59582962-59582984 CTGTGGAATGCTGCCATGGAGGG - Intronic
995002553 5:107152192-107152214 CTGAGCAAACCTCAGATGTATGG + Intergenic
996367144 5:122715237-122715259 CTGAGTCATGCTCACATGTCTGG + Intergenic
999460323 5:151752159-151752181 CTGAGCAATGCTGATCTGGTGGG + Intronic
1001203527 5:169741119-169741141 CTCAGCAATGGTCAGATGGCTGG - Intronic
1001801526 5:174548445-174548467 CAGAGCAATGCACCCATGGTTGG - Intergenic
1003816480 6:9846970-9846992 CTGAGCAAAGATCACATGCCAGG - Intronic
1019049389 6:169171356-169171378 CTCAGCATTTCCCACATGGAAGG - Intergenic
1021927844 7:25550492-25550514 CTGAGCAGTGTTCTGATGGATGG - Intergenic
1024007878 7:45240976-45240998 ATGAGCCTTGCTCACCTGGATGG - Intergenic
1024692596 7:51819096-51819118 CTGACCAGTGCACACAGGGATGG + Intergenic
1025477834 7:60948729-60948751 CTGATCAATGCATATATGGAAGG + Intergenic
1025554296 7:62285216-62285238 CTGATCAATGCATATATGGAAGG - Intergenic
1025560485 7:62368058-62368080 CTGATCAATGCATATATGGAAGG + Intergenic
1026953985 7:74365376-74365398 CTGAGTAAGGGGCACATGGATGG - Intronic
1030251343 7:107448525-107448547 CTGAGGAATTCTAACATGTAAGG - Intronic
1033725388 7:144110453-144110475 CTGAGGAATGCTCAGTTGAAGGG + Exonic
1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG + Intergenic
1034457456 7:151178771-151178793 ATGAGCACTGCTCAGATGCAGGG - Intronic
1035665490 8:1376883-1376905 CAGAGCAAGGCCCACATCGAAGG + Intergenic
1037534339 8:19810862-19810884 CTGAGCAAACCCCACATGGCTGG - Intergenic
1040432849 8:47361302-47361324 CTAACCAATGGTCAGATGGATGG - Intronic
1041568489 8:59308558-59308580 CTGATCAATGCACATGTGGAGGG + Intergenic
1042193725 8:66213857-66213879 CTGAACCATGCTCTTATGGAAGG + Intergenic
1042537307 8:69871464-69871486 ATGAGCTCTGCTCACAAGGATGG - Intergenic
1044763060 8:95542748-95542770 CTAAGCAATGCAGACATGGCTGG + Intergenic
1045608769 8:103810274-103810296 CTGGGCTATGCTGACAAGGAAGG + Intronic
1045987987 8:108272301-108272323 TTGAGCAATGATCACATTGCTGG - Intronic
1051281852 9:15449242-15449264 TTGAGCAATGTTCAGATGGTTGG - Intronic
1051697004 9:19779384-19779406 AGGAGCAATGTTTACATGGATGG + Intronic
1053518820 9:38756023-38756045 CTCAGCAGTGCTGACATGAAGGG - Intergenic
1054801465 9:69353931-69353953 CTGGGCAATGGGTACATGGAGGG - Intronic
1057705169 9:97390607-97390629 GTGAGCAACACTCACAGGGAAGG + Intergenic
1057744298 9:97739351-97739373 CTGAGGACTGCTCCCAAGGAGGG - Intergenic
1058793780 9:108477089-108477111 CTGAGATATGCACACATTGAGGG + Intergenic
1061161856 9:128900087-128900109 CTGAGGAATCCCCACAGGGAGGG - Intronic
1061723817 9:132570496-132570518 CTGAGAAATGCTGCCATGGAGGG + Intronic
1187186954 X:16996033-16996055 CTGAGCAATGCTTGCCAGGATGG - Intronic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1193588342 X:83355698-83355720 CTGGGCAATGCTGACGTGTATGG + Intergenic
1196103365 X:111870716-111870738 GTGAGCAATACTCACCTGGCAGG - Intronic
1197702324 X:129608615-129608637 CTGAGGAAAGCGCACATGGCTGG + Intergenic
1197869060 X:131048795-131048817 CTGAGCAATGCTCCCATTTAGGG + Intergenic
1199692336 X:150318109-150318131 TTGAGCATTGCTGAGATGGAGGG - Intergenic
1200276137 X:154734662-154734684 CTGAGCAAGGCGCTCAGGGAGGG + Intronic