ID: 1152294157

View in Genome Browser
Species Human (GRCh38)
Location 17:79456926-79456948
Sequence CAGCACCTGCCCATTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 200}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152294154_1152294157 -4 Left 1152294154 17:79456907-79456929 CCCAAGTTGTTCTGTATCACAGC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1152294157 17:79456926-79456948 CAGCACCTGCCCATTCCCATGGG 0: 1
1: 0
2: 2
3: 30
4: 200
1152294149_1152294157 10 Left 1152294149 17:79456893-79456915 CCCATCCTAAATCCCCCAAGTTG 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1152294157 17:79456926-79456948 CAGCACCTGCCCATTCCCATGGG 0: 1
1: 0
2: 2
3: 30
4: 200
1152294147_1152294157 16 Left 1152294147 17:79456887-79456909 CCTCCTCCCATCCTAAATCCCCC 0: 1
1: 0
2: 2
3: 41
4: 516
Right 1152294157 17:79456926-79456948 CAGCACCTGCCCATTCCCATGGG 0: 1
1: 0
2: 2
3: 30
4: 200
1152294152_1152294157 -2 Left 1152294152 17:79456905-79456927 CCCCCAAGTTGTTCTGTATCACA 0: 1
1: 0
2: 0
3: 18
4: 133
Right 1152294157 17:79456926-79456948 CAGCACCTGCCCATTCCCATGGG 0: 1
1: 0
2: 2
3: 30
4: 200
1152294150_1152294157 9 Left 1152294150 17:79456894-79456916 CCATCCTAAATCCCCCAAGTTGT 0: 1
1: 0
2: 1
3: 6
4: 224
Right 1152294157 17:79456926-79456948 CAGCACCTGCCCATTCCCATGGG 0: 1
1: 0
2: 2
3: 30
4: 200
1152294151_1152294157 5 Left 1152294151 17:79456898-79456920 CCTAAATCCCCCAAGTTGTTCTG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1152294157 17:79456926-79456948 CAGCACCTGCCCATTCCCATGGG 0: 1
1: 0
2: 2
3: 30
4: 200
1152294155_1152294157 -5 Left 1152294155 17:79456908-79456930 CCAAGTTGTTCTGTATCACAGCA 0: 1
1: 0
2: 1
3: 18
4: 217
Right 1152294157 17:79456926-79456948 CAGCACCTGCCCATTCCCATGGG 0: 1
1: 0
2: 2
3: 30
4: 200
1152294148_1152294157 13 Left 1152294148 17:79456890-79456912 CCTCCCATCCTAAATCCCCCAAG 0: 1
1: 0
2: 0
3: 21
4: 237
Right 1152294157 17:79456926-79456948 CAGCACCTGCCCATTCCCATGGG 0: 1
1: 0
2: 2
3: 30
4: 200
1152294153_1152294157 -3 Left 1152294153 17:79456906-79456928 CCCCAAGTTGTTCTGTATCACAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1152294157 17:79456926-79456948 CAGCACCTGCCCATTCCCATGGG 0: 1
1: 0
2: 2
3: 30
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152294157 Original CRISPR CAGCACCTGCCCATTCCCAT GGG Intronic
900374123 1:2345548-2345570 CAGCACCTGCCCCTCGCCAGTGG + Intronic
900812828 1:4820990-4821012 CTGCATCTGGGCATTCCCATGGG - Intergenic
901870993 1:12139180-12139202 CAGCAGCTTCCCATTCCCTATGG + Intronic
902607635 1:17577589-17577611 CAAGCCCTGCCCATACCCATAGG - Intronic
903974966 1:27143535-27143557 CAGCACTGGCCCACTCCCAAAGG + Intronic
904827281 1:33281717-33281739 CAGCACCTGCGCATCCACCTGGG + Exonic
904941986 1:34170400-34170422 TCTCACCTGCCCTTTCCCATAGG - Intronic
906107893 1:43305620-43305642 CAGCACCTGCTAACTCCCAGGGG - Intronic
906247036 1:44283597-44283619 CAGCAGCTGCCCAGTTTCATGGG + Intronic
907278392 1:53329151-53329173 CAGCACCTGCCCATCCGCGAGGG - Intergenic
907786080 1:57614092-57614114 CAGCAGCTGCCCCTTTCGATGGG - Intronic
908817185 1:68046725-68046747 CAGCTCCTGCACATTCACATCGG + Exonic
910130063 1:83893843-83893865 CATCCCCTGCCCCTTCCCCTAGG - Intronic
911006312 1:93228318-93228340 CAGCTACTGGCCATTCCCATTGG + Intronic
912527235 1:110292419-110292441 CAGCTTCTCCCCATTCACATCGG + Intergenic
915127953 1:153678993-153679015 CCGCTCCTGCTCCTTCCCATAGG + Exonic
915354531 1:155248155-155248177 CTGCACCTGCCCACTCCCTGGGG - Exonic
915524420 1:156467281-156467303 CGGCACCTGTCCTTTCCCAAAGG + Exonic
922782941 1:228268195-228268217 CACGCCCTGCCCAGTCCCATGGG + Intronic
1062761756 10:27974-27996 CAGCACCTCACAAGTCCCATTGG + Intergenic
1062930079 10:1347108-1347130 CAGGACTGGCCCATTCCCTTCGG + Intronic
1063287787 10:4709245-4709267 CAGCACCACCACATTCACATTGG - Intergenic
1063384510 10:5607689-5607711 CAGCTCCTGCCCAGCCCCAAAGG - Intergenic
1067342888 10:45418988-45419010 CTGCCCCCGCCCATTCTCATGGG - Intronic
1069537216 10:69263455-69263477 CAGCACCTACCAATTCCCACTGG - Intronic
1069679361 10:70273148-70273170 CAGCTCCTGCCCCTTCCAACTGG + Intronic
1069993929 10:72331355-72331377 GAGCAGCTGCCCATTCCAGTAGG - Intergenic
1071329915 10:84549007-84549029 CAGAACTTGCTCCTTCCCATTGG - Intergenic
1073025107 10:100482068-100482090 CAGCAGCTGCCTATTTCCAAGGG - Intronic
1075351979 10:121732297-121732319 CAGAACATGCCCATTCCAATGGG - Intergenic
1075786358 10:125052776-125052798 CAGCCCCAACACATTCCCATGGG + Intronic
1075821393 10:125315820-125315842 AAGCACCAGCCCATTGTCATGGG - Intergenic
1077551443 11:3202275-3202297 CTGCACCTGCCCCTTCCCTGGGG + Intergenic
1078654615 11:13226531-13226553 CAACACCTTCTCATTCCCTTTGG - Intergenic
1079645073 11:22852660-22852682 AACCAGCAGCCCATTCCCATAGG + Intronic
1080586525 11:33687880-33687902 CAGCACCTGGCCTTTCCCAGAGG - Intergenic
1081269415 11:41065442-41065464 CTGCACCGGCCCCTCCCCATAGG - Intronic
1081990882 11:47336951-47336973 CAGCCCTTGCCCCATCCCATAGG + Intronic
1083708510 11:64532851-64532873 CACCACCTGTCACTTCCCATTGG + Intergenic
1083758813 11:64804929-64804951 CAGCATCTGCCCATCCCCTTGGG - Intronic
1085050860 11:73379481-73379503 CAGCACCTGCCCCTACTCATAGG + Intronic
1086424683 11:86672052-86672074 GAGCACCTGCCCTCTCCCAGAGG - Intronic
1089181117 11:116583461-116583483 CAGCAGCTGCCCCTTTCCATTGG - Intergenic
1089632675 11:119793473-119793495 CAGAACACACCCATTCCCATGGG - Intergenic
1090204379 11:124876509-124876531 AAGCCCCTGCCCCTCCCCATGGG - Intronic
1090450944 11:126805875-126805897 CGGCACCTGCCCAGGCCCACTGG - Intronic
1091338747 11:134794316-134794338 CAGGGGCTGCCCATCCCCATAGG - Intergenic
1092168899 12:6360915-6360937 CAGGGCCGGCCCATTCCCAAGGG + Intronic
1093690214 12:22101698-22101720 CTGCACCTGCCCCTCCCCACTGG - Intronic
1095038633 12:37420040-37420062 CAGCCCCAGCCCAGTCCCTTTGG + Intergenic
1095048950 12:37540733-37540755 CAGCCCCAGCCCAGTCCCTTTGG - Intergenic
1096572743 12:52533156-52533178 CAGTTCCTGCCCAGTCCCAAAGG + Intergenic
1097074548 12:56383355-56383377 CAGCACCTGCCCATATCTATAGG + Intergenic
1097249842 12:57626483-57626505 CTCCCCCTGCCCATTCTCATGGG - Exonic
1104665277 12:130643268-130643290 CAGCAGCTCCCCACTCCCATTGG + Intronic
1105016442 12:132788719-132788741 CAGCTTCTCCCCATTGCCATGGG - Intronic
1106558654 13:30830876-30830898 CAGCACCTGCTCTCTCCCCTGGG - Intergenic
1107459275 13:40585739-40585761 CAGCAGCTGCCCATTTTCAAGGG + Intronic
1109135875 13:58649899-58649921 CAGCTGCTTCCCAATCCCATGGG - Intergenic
1111652215 13:91105768-91105790 CAGAATTTTCCCATTCCCATTGG - Intergenic
1112152508 13:96779395-96779417 CAATAACAGCCCATTCCCATAGG - Intronic
1113372324 13:109734555-109734577 CAGCACCTGCAGGGTCCCATGGG + Intergenic
1114191327 14:20441458-20441480 GAGCACCTGCCTTGTCCCATGGG - Intergenic
1114195035 14:20469562-20469584 CAGCACCTGCCCCTCCCCAAGGG - Intronic
1114533831 14:23410964-23410986 CAGCCCCCGACCATTCTCATAGG + Intergenic
1115457175 14:33617013-33617035 CAGCACCTTCACTTTCCCAAAGG + Intronic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1119475125 14:74922756-74922778 CGGGTCCTGCCCATTCCCAGTGG - Intronic
1121483211 14:94294019-94294041 CTGCACCTGCCCAGGCCCTTAGG - Intergenic
1122151788 14:99729823-99729845 CGGCACCGGCCCATGCACATTGG - Intergenic
1122419640 14:101567258-101567280 GTGCACCTGCCCACCCCCATCGG - Intergenic
1122916743 14:104862886-104862908 CTGCATCTGCCCAGTCCCAGCGG + Intergenic
1127601451 15:60541549-60541571 CAGCTCCTGCCACTTCCCCTTGG - Intronic
1127978712 15:64018276-64018298 CAGCACTTGGCCAGTCCCAAGGG + Intronic
1127998801 15:64171854-64171876 CAGCTCCTGCCATTTCTCATTGG - Exonic
1130448317 15:84025324-84025346 CACCACCTGCACAGTTCCATTGG - Exonic
1130942717 15:88524317-88524339 CAGCAGCTGCCCAGTCCAAGAGG + Intronic
1132864247 16:2085780-2085802 CAGGCCCTGCCCTTTCCCTTGGG - Intronic
1133258874 16:4535775-4535797 CAGAACCTCCCCATGCCCAGAGG - Intronic
1134831955 16:17331035-17331057 CAGGTCCTGGCCATTCCCATGGG + Intronic
1140773505 16:78228051-78228073 CAGCACCTGCCCAGGGCTATGGG + Intronic
1141666148 16:85466351-85466373 CAGCCCCTGCCCACTCCCCAGGG - Intergenic
1142282264 16:89154717-89154739 CAGAACCAGCCCTGTCCCATGGG + Exonic
1142354693 16:89596921-89596943 CAGTCCCTGCCCCTTCTCATCGG - Exonic
1143893145 17:10117554-10117576 CAGCACCTGCTCCTCCCCGTTGG - Intronic
1145267172 17:21385505-21385527 CAGCACCTGCCCAGTCAGAGCGG + Intronic
1145293810 17:21573001-21573023 CAGCCCCAGCCCAGTACCATTGG + Intronic
1145386169 17:22412982-22413004 CAGCCCCAGCCCAGTCCCATTGG - Intergenic
1145395911 17:22494796-22494818 CAGCAACTGTCCATTCCCTTTGG - Intergenic
1146482655 17:33217520-33217542 GAGTACTTGCCCTTTCCCATAGG + Intronic
1146657476 17:34643383-34643405 CAGCACCTGCCCTTTCCCTTGGG + Intergenic
1148335465 17:46837999-46838021 CAGTACCTGCTCACTCCCTTGGG - Intronic
1150303740 17:64066892-64066914 CACCACCAGCCCATCACCATTGG + Exonic
1152294157 17:79456926-79456948 CAGCACCTGCCCATTCCCATGGG + Intronic
1152308189 17:79533322-79533344 CTACACCTGGCCATGCCCATTGG + Intergenic
1152926725 17:83090755-83090777 CAGCACCTGCCCCGTACCACAGG - Intronic
1152954663 18:28304-28326 CAGCACCTCACAAGTCCCATTGG + Intergenic
1153449260 18:5208684-5208706 CAGGACCTGCCACTTCTCATTGG + Intergenic
1153634728 18:7103875-7103897 CAGCCCCTGCCCCTCCCCAGCGG + Intronic
1155576356 18:27252065-27252087 CAGCACCTCCCTTTTCCCAATGG - Intergenic
1155857294 18:30849868-30849890 CTGCAGCTGCCCCTTCCCAAAGG + Intergenic
1155995118 18:32323088-32323110 CAGCACCTGCTGGTTCCCAGAGG + Intronic
1156556282 18:38071780-38071802 AAGCACCTGCCCCTGCCTATAGG - Intergenic
1156862626 18:41855701-41855723 CATCTCCTGCCCATTCGCAGTGG - Intergenic
1157572564 18:48722790-48722812 AAGCACCCGGCCATACCCATCGG + Intronic
1160043959 18:75369882-75369904 CAGAACCAGCCCACTTCCATGGG + Intergenic
1161309598 19:3586371-3586393 CACGCCCTGCCCTTTCCCATGGG + Intronic
1162086602 19:8253269-8253291 CAGCCCCAGCCCCTGCCCATGGG + Intronic
1162964839 19:14150891-14150913 CTGCATCTGCCCGTCCCCATCGG + Exonic
1163427709 19:17248153-17248175 CAGGATCTGGCCATTCCCACGGG - Intronic
1164401570 19:27905612-27905634 CAGCAGCTGCTCCTGCCCATGGG + Intergenic
1165595547 19:37009207-37009229 CAGCCCCAGCCCAGTCCCTTTGG - Intronic
1165595963 19:37011487-37011509 CAGCCCCAGCCCAATCCCTTTGG - Intronic
1165601903 19:37060881-37060903 CAGCCCCAGCCCAGTCCCGTTGG - Intronic
1166373468 19:42314712-42314734 CAGCACCTGCCCACTCCCCCAGG - Intronic
1167523109 19:49968849-49968871 CAGCACCTCCCGATTCCCCAAGG - Intergenic
926219270 2:10924383-10924405 CTGCACCTGCCCATCCCCGCTGG + Intergenic
927670614 2:25065836-25065858 CAGCACCTGCCCATTCACACTGG - Intronic
928407851 2:31028532-31028554 CACCACCTGCCCTTCCCCATGGG + Intronic
928759985 2:34570652-34570674 GAGCAGCTTCCCTTTCCCATAGG + Intergenic
929924939 2:46200355-46200377 CAGGACCTGCTCATTCTCAGGGG - Intergenic
931704469 2:64935876-64935898 GAGAACTTGCCCATTACCATGGG - Intergenic
932219670 2:69989945-69989967 CAGCACATGGCCCTTGCCATGGG + Intergenic
934900614 2:98156943-98156965 GAGCACCTACCCTTTACCATGGG + Intronic
935121925 2:100190670-100190692 CAAAACCTGCCCAGGCCCATGGG + Intergenic
935351035 2:102151981-102152003 CAGCACCTGACCCATCCCATCGG - Intronic
935380422 2:102446227-102446249 CAGGAACTGCCCATTCCCCTGGG + Intronic
938278619 2:130049685-130049707 CAGGACCTCCCTATTCCCATGGG + Intergenic
938329595 2:130440544-130440566 CAGGACCTCCCTATTCCCATGGG + Intergenic
938360353 2:130680959-130680981 CAGGACCTCCCTATTCCCATGGG - Intergenic
938436755 2:131287667-131287689 CAGGACCTCCCTATTCCCATGGG - Intronic
941166488 2:162088562-162088584 CAGTATCTGACCATTCCCATTGG - Intergenic
941994219 2:171586339-171586361 CAGCCCCACCCCATCCCCATAGG + Intergenic
946331710 2:219013281-219013303 CAGTTCATCCCCATTCCCATTGG - Exonic
947312930 2:228823890-228823912 CAACACCTGACTTTTCCCATTGG - Intergenic
947404504 2:229760809-229760831 CCACTCCTGCCCACTCCCATGGG + Intergenic
947606192 2:231487377-231487399 CAGCACCTGCCCAGCCTCCTTGG + Intergenic
1168873150 20:1147980-1148002 CAGCCTCTGCTCCTTCCCATAGG + Intronic
1168965536 20:1895814-1895836 CAGCCCCTGCCCGGTCCAATGGG + Intronic
1170578742 20:17682437-17682459 CAGCTCCTCCCCTCTCCCATTGG - Intergenic
1170957205 20:20992060-20992082 CATGCCCTGCCCTTTCCCATTGG + Intergenic
1171532026 20:25859256-25859278 CAGCTCCAGCCCAGTCCCTTTGG + Intronic
1171533419 20:25866720-25866742 CAGCCCCAGCCCAGTCCCTTTGG + Intronic
1171543483 20:25984217-25984239 CAGCCCCAGCCCAGTCCCTTTGG - Intergenic
1171846520 20:30280839-30280861 CAGCCCCAGCCCAGTCCCTTTGG - Intergenic
1172202101 20:33133642-33133664 CATCACCTGCGCATTCCCCAGGG - Intergenic
1175527554 20:59646024-59646046 AAGCTCCTGCCCAGTCCCGTGGG + Intronic
1175918064 20:62436787-62436809 CAGAACCTGCCCATGACCTTTGG + Intergenic
1175954871 20:62604086-62604108 CAGCACCTGCCCAGCCCTCTGGG + Intergenic
1176139801 20:63539953-63539975 CAGCTCCTGCCAATGCCCTTGGG + Intergenic
1179729371 21:43359033-43359055 CAGCACCTGCCCCTCCGCATTGG + Intergenic
1181712471 22:24699213-24699235 AATCTCCTGCCCATTCCCAGAGG + Intergenic
1181768073 22:25106212-25106234 CAGCCTCAGCCCAGTCCCATGGG + Intronic
1185272679 22:49936054-49936076 CAGCCCGTGCCCAGCCCCATAGG + Intergenic
950422332 3:12906408-12906430 CAGCACCTGCCTGTCCCGATGGG + Intronic
953135205 3:40175928-40175950 CAGCAGCTGCACATCCCCAGGGG - Intronic
954623223 3:52007344-52007366 CAGCCACTTCCCAGTCCCATTGG - Intergenic
954639846 3:52091298-52091320 CAGCTCCTGAGAATTCCCATAGG + Intronic
954749998 3:52808062-52808084 CAGCCCCTGGCCATTGCCACGGG - Intronic
955020267 3:55114107-55114129 CAGCACCTGAGAGTTCCCATTGG - Intergenic
955996075 3:64682157-64682179 CAGCACCTACCCATTCACCTTGG + Intronic
956355768 3:68390399-68390421 CCACAGCTGCCCCTTCCCATAGG - Intronic
957042320 3:75345397-75345419 CAGCCCCTTCCCATTTCCAGGGG + Intergenic
960293526 3:115915146-115915168 CTGCACCTTTCCATTCCCTTTGG + Intronic
961047047 3:123716247-123716269 CAGCCCCTTCCCATTTCCAGGGG + Intronic
965709628 3:171544173-171544195 CAGCACCAGCCCAACCCCAGAGG + Intergenic
965959863 3:174416366-174416388 CACCACGTGCCCACTCCCATAGG + Intergenic
968359059 3:198133834-198133856 CAGCACCTCACAAGTCCCATTGG - Intergenic
968504438 4:965389-965411 TAGCACCTGACCTTTCCCTTGGG - Intronic
969118668 4:4890670-4890692 CAGCTCCTGTCCTTTCCCACAGG + Intergenic
969392902 4:6902557-6902579 CAGCTCCTTCCCACTCCCGTGGG - Intergenic
969680344 4:8639836-8639858 CAGCTCCTGCCCATTTCCAGGGG - Intergenic
970060511 4:12027982-12028004 CAGCACATGCTAATTTCCATTGG + Intergenic
977340272 4:95749309-95749331 CAGCACCTGCCTCTTCCTGTAGG - Intergenic
984144460 4:176044295-176044317 CAAAACCTGCCCACTCCCACAGG + Intergenic
985520238 5:370743-370765 CAACACCTGCACCTTCCCATGGG - Intronic
986195482 5:5533645-5533667 GGGCACCGGCCCATGCCCATAGG - Intergenic
1000031126 5:157402217-157402239 CAGCACCTGCACATACCACTGGG + Intronic
1002579268 5:180197712-180197734 AAGCACCTGCACAGTGCCATTGG - Intronic
1003231406 6:4257012-4257034 CAGCACCTGCAAATACCCAAGGG + Intergenic
1003908781 6:10725184-10725206 CAGCTCCTGCCCTTGCCCTTTGG + Intronic
1007832134 6:44646774-44646796 CTGCACCTGCCCAAACCCAAAGG + Intergenic
1012142667 6:95643063-95643085 TGGCAGCTGCCCCTTCCCATGGG - Intergenic
1018733295 6:166669251-166669273 CAGCACCTGCTCCTTCCCCCGGG + Intronic
1018777926 6:167035467-167035489 CAGAACTTGCCCATTCCACTGGG - Intronic
1019267159 7:124341-124363 CTGCGCCTGCCCCTTCCCACCGG - Intergenic
1022537006 7:31104595-31104617 CAGATCCTTCCCATTCCCAAAGG - Intronic
1022753604 7:33259836-33259858 CCTCTCCTTCCCATTCCCATTGG + Intronic
1025110715 7:56213846-56213868 TAGCATCTGCTCTTTCCCATGGG - Intergenic
1025294862 7:57769314-57769336 CAGCCCCAGCCCAGTCCCTTTGG - Intergenic
1025301254 7:57821150-57821172 CAGCCCCAGCCCAGTCCCTTTGG - Intergenic
1027986776 7:85302377-85302399 CAGAACCTGCCCATTCACCAGGG - Intergenic
1032069151 7:128792948-128792970 CAGCAACTGCCAAGTCACATGGG - Intronic
1032390917 7:131555071-131555093 CAGCGCCTGCCCACTACCAAAGG + Intronic
1032729104 7:134620077-134620099 CAGCAGCTGCTTGTTCCCATGGG - Intergenic
1034477209 7:151292343-151292365 CAGCAGCAGCCAATTCCCCTTGG + Intergenic
1035456817 7:159014180-159014202 CAGCACCTGCCCATGCCCTCTGG - Intergenic
1035741231 8:1929953-1929975 CAGCAGCTGCCCACCCCCAGCGG - Intronic
1038289335 8:26234926-26234948 CTGCACCTGCCCCTCCCCACTGG + Intergenic
1039435447 8:37556557-37556579 CAATACCTGCCCCTTCTCATGGG + Intergenic
1039448284 8:37649712-37649734 CAGCTCCTGTCCATTCCTTTGGG + Intergenic
1039739619 8:40370290-40370312 CCCCACCACCCCATTCCCATAGG + Intergenic
1039764468 8:40613482-40613504 CCTCACCTGCCCATTCAAATTGG + Intronic
1041098276 8:54371633-54371655 CAGCACCTGCCCATCCTTCTAGG + Intergenic
1042235638 8:66611113-66611135 CAGAACCTTCCCCTCCCCATGGG - Intronic
1042387925 8:68199223-68199245 CAAGACCAGCCCATTACCATTGG + Intronic
1042517802 8:69677954-69677976 CAGAAGCTGCCCAGACCCATGGG + Intronic
1044465993 8:92506419-92506441 CAGCTCCTCTGCATTCCCATAGG - Intergenic
1048864118 8:138746841-138746863 CAGCCCCTGCCCTTTCTCAGTGG + Intronic
1049554784 8:143276439-143276461 CAGCACCTGCGCATCCACAACGG + Exonic
1049747276 8:144268343-144268365 CAGCACCTGCCCGGGCCCACTGG + Exonic
1051591294 9:18778344-18778366 CAGCACCTGCTGTTTCCCATGGG + Intronic
1051607271 9:18928215-18928237 AGGCACCTGCCCATTTCCTTGGG + Exonic
1053286153 9:36850747-36850769 CAGCACATGGCCATTCTCAGAGG + Intronic
1053785045 9:41647283-41647305 CAGCCCCAGCCCAGTCCCTTTGG + Intergenic
1054159972 9:61666899-61666921 CAGCCCCAGCCCAGTCCCTTTGG - Intergenic
1054172623 9:61855649-61855671 CAGCCCCAGCCCAGTCCCTTTGG - Intergenic
1054173772 9:61861234-61861256 CAGCCCCAGCCCAGTCCCTTTGG + Intergenic
1054448629 9:65390299-65390321 CAGCCCCAGCCCAGTCCCTTTGG + Intergenic
1054663768 9:67719547-67719569 CAGCCCCAGCCCAGTCCCTTTGG - Intergenic
1054664917 9:67725152-67725174 CAGCCCCAGCCCAGTCCCTTTGG + Intergenic
1057505844 9:95632805-95632827 CTGCAGGTGCCCATTCGCATGGG + Intergenic
1058959683 9:109980725-109980747 CAGCTCCAGCCCATCACCATGGG - Intronic
1061941572 9:133886950-133886972 CAGGACTTTCCCAGTCCCATGGG + Intronic
1062743686 9:138196970-138196992 CAGCACCTCACAAGTCCCATTGG - Intergenic
1186906281 X:14114432-14114454 CAGAACCTGCCCAGACCCAAGGG - Intergenic
1189682983 X:43535967-43535989 CTTCACCTGACCATTCCCACTGG - Intergenic
1190060263 X:47206314-47206336 CACCACCTGCACATTGCCTTTGG - Exonic
1191864240 X:65690983-65691005 AAGCACCTTCCCATGCCCCTAGG - Intronic
1192209820 X:69120617-69120639 CCCCACCTGGCCATTCCTATCGG - Intergenic
1197109428 X:122755638-122755660 CAGCAGCTGCCCAAGGCCATGGG - Intergenic
1201433406 Y:13929477-13929499 CAGCACCTTCCCATTTTCAAAGG + Intergenic
1201725925 Y:17152217-17152239 CAGCTCCTGCACCTGCCCATCGG - Intergenic