ID: 1152294574 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:79459224-79459246 |
Sequence | TCACCTCTATGGGGCCCTGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 172 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 15, 4: 155} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1152294565_1152294574 | 24 | Left | 1152294565 | 17:79459177-79459199 | CCCAGGTGGCTCTCAGAGTGCAT | 0: 1 1: 0 2: 2 3: 10 4: 149 |
||
Right | 1152294574 | 17:79459224-79459246 | TCACCTCTATGGGGCCCTGGAGG | 0: 1 1: 0 2: 1 3: 15 4: 155 |
||||
1152294566_1152294574 | 23 | Left | 1152294566 | 17:79459178-79459200 | CCAGGTGGCTCTCAGAGTGCATA | 0: 1 1: 0 2: 0 3: 9 4: 103 |
||
Right | 1152294574 | 17:79459224-79459246 | TCACCTCTATGGGGCCCTGGAGG | 0: 1 1: 0 2: 1 3: 15 4: 155 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1152294574 | Original CRISPR | TCACCTCTATGGGGCCCTGG AGG | Intronic | ||