ID: 1152294574

View in Genome Browser
Species Human (GRCh38)
Location 17:79459224-79459246
Sequence TCACCTCTATGGGGCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152294565_1152294574 24 Left 1152294565 17:79459177-79459199 CCCAGGTGGCTCTCAGAGTGCAT 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1152294574 17:79459224-79459246 TCACCTCTATGGGGCCCTGGAGG 0: 1
1: 0
2: 1
3: 15
4: 155
1152294566_1152294574 23 Left 1152294566 17:79459178-79459200 CCAGGTGGCTCTCAGAGTGCATA 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1152294574 17:79459224-79459246 TCACCTCTATGGGGCCCTGGAGG 0: 1
1: 0
2: 1
3: 15
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152294574 Original CRISPR TCACCTCTATGGGGCCCTGG AGG Intronic