ID: 1152294574

View in Genome Browser
Species Human (GRCh38)
Location 17:79459224-79459246
Sequence TCACCTCTATGGGGCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152294566_1152294574 23 Left 1152294566 17:79459178-79459200 CCAGGTGGCTCTCAGAGTGCATA 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1152294574 17:79459224-79459246 TCACCTCTATGGGGCCCTGGAGG 0: 1
1: 0
2: 1
3: 15
4: 155
1152294565_1152294574 24 Left 1152294565 17:79459177-79459199 CCCAGGTGGCTCTCAGAGTGCAT 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1152294574 17:79459224-79459246 TCACCTCTATGGGGCCCTGGAGG 0: 1
1: 0
2: 1
3: 15
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152294574 Original CRISPR TCACCTCTATGGGGCCCTGG AGG Intronic
900136772 1:1121082-1121104 TCACCTCTATGCGGTCCCTGGGG + Intergenic
900937564 1:5776148-5776170 GCTCCTCTATGGGGCCCCAGAGG - Intergenic
901358571 1:8675082-8675104 TCAAATCCATGGGGCCCTGGGGG + Intronic
901770942 1:11530093-11530115 GAACCCCTATGGGCCCCTGGGGG + Intronic
901811902 1:11772145-11772167 TGTCCTCTGTGTGGCCCTGGTGG - Exonic
902262638 1:15238323-15238345 TCACCTCTCTGGGTTTCTGGAGG - Intergenic
904928712 1:34069120-34069142 CCACATTTATGAGGCCCTGGGGG - Intronic
912763679 1:112389993-112390015 CCACCTCCATGAGGCCATGGCGG + Intergenic
913155379 1:116092144-116092166 TCACATCTCTGGGTCCCTTGTGG - Intergenic
913971284 1:143420159-143420181 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
914065661 1:144245772-144245794 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
914113490 1:144720582-144720604 GCAGCTCTATGGAGGCCTGGCGG - Intergenic
914192863 1:145425979-145426001 TCACCTCTCAGGGGAGCTGGGGG - Intergenic
920379123 1:205525755-205525777 TCACCTCTTTGGGCTCCTGGAGG - Intronic
921840542 1:219823510-219823532 GCTCCACTATGGTGCCCTGGTGG + Intronic
924439507 1:244074580-244074602 TCACATCTGTGGTGCCCAGGTGG - Intergenic
1063002772 10:1940153-1940175 TCAACACGATGGGCCCCTGGAGG - Intergenic
1067044822 10:42979602-42979624 TCACCTTCACGCGGCCCTGGTGG + Intergenic
1069691849 10:70358821-70358843 TCACCTCTTGTGGGTCCTGGAGG - Intronic
1069833194 10:71293555-71293577 TCACCTCCCAGTGGCCCTGGTGG - Exonic
1069995931 10:72342218-72342240 TCCCGGCTAGGGGGCCCTGGTGG - Intronic
1070318977 10:75340127-75340149 TCACCTGAATGGGGGCCTGGTGG + Intergenic
1070706295 10:78641558-78641580 TCAATTCTGTGTGGCCCTGGGGG - Intergenic
1070794588 10:79209371-79209393 TGACTTCCATGGGGCCCTGTTGG - Intronic
1071565206 10:86668123-86668145 TATCCAGTATGGGGCCCTGGAGG - Intergenic
1073330311 10:102666153-102666175 TCACCTCTGTGCAGCCCTCGTGG + Intergenic
1073470888 10:103721429-103721451 CCACCTCTAGGAGGCCCTTGAGG - Intronic
1074049872 10:109871822-109871844 TCACAGCTATGTGGCCCTTGAGG + Exonic
1074267149 10:111915854-111915876 TTACCAATATGGGGCTCTGGAGG + Intergenic
1077294749 11:1820942-1820964 TTCCCTCCATGTGGCCCTGGGGG + Intergenic
1077310472 11:1886758-1886780 GCAGCTCTATGGAGGCCTGGCGG - Exonic
1077453567 11:2664920-2664942 TCACCTCTCTGGGGCCCTGCGGG - Intronic
1077497100 11:2891661-2891683 TCACCCCTACTGGGCCCTCGGGG + Intronic
1078442863 11:11381711-11381733 TCACCTGTCTGGGGCCTTTGTGG - Intronic
1078853521 11:15187035-15187057 TCACATGTATGGTGCCATGGAGG + Intronic
1079937919 11:26640917-26640939 TCACCTTCATGAGGCTCTGGAGG + Intronic
1084531173 11:69728745-69728767 GCCCCTCTTTGGGGTCCTGGGGG - Intergenic
1087334367 11:96824726-96824748 ACACCTCTCTGGGGGCCTTGGGG + Intergenic
1089456767 11:118630291-118630313 TCACCTCTCAGGGGCCTAGGAGG - Intronic
1089466505 11:118689617-118689639 TCACCTGCATGTGGGCCTGGAGG - Intergenic
1091680526 12:2523565-2523587 TCAGCACTATGGGGCCCCGGGGG + Intronic
1091693986 12:2615957-2615979 TCACCCCTCTGCGGCCCAGGTGG - Intronic
1091996223 12:4996272-4996294 TCACCTCTATGGAGAGCAGGAGG + Intergenic
1099365626 12:81763064-81763086 TCACCTCTAGGGGCCCCCTGGGG - Intergenic
1100271456 12:93029245-93029267 TCTGCTCTCTGGAGCCCTGGGGG - Intergenic
1102027167 12:109720176-109720198 GCAGCTGTTTGGGGCCCTGGGGG + Intronic
1103371859 12:120425272-120425294 TCACCTCTGGGTGGGCCTGGTGG - Intergenic
1105926938 13:25017429-25017451 GCAGCTCTATGGAGGCCTGGCGG - Intergenic
1111016490 13:82388214-82388236 TCACCTCTAAGGGGCCCACCGGG + Intergenic
1114318089 14:21525377-21525399 TCTCCTCTCTGGGCCCCAGGTGG + Exonic
1114466804 14:22929006-22929028 TAAACTCTAAAGGGCCCTGGAGG - Intronic
1115806301 14:37055685-37055707 TCACATGTCTGGGGCCTTGGTGG - Intronic
1117071693 14:52063293-52063315 TCTCCTCTCTGGGATCCTGGGGG - Intronic
1121637530 14:95463750-95463772 GCTCCTCTCTGGGGCCCTGCGGG + Intronic
1122623081 14:103070739-103070761 TCCCCTCTCCTGGGCCCTGGTGG - Intergenic
1124132255 15:27001332-27001354 TCACCCCTCTGAGGCCCAGGTGG + Intronic
1127819203 15:62640413-62640435 ATACCTCAATGGGGCCGTGGAGG - Intronic
1131993737 15:98114583-98114605 TCACCTCTCTGGGCCCCAGATGG - Intergenic
1132610919 16:816012-816034 TCACCTCCACGGGACCCTGCGGG - Intergenic
1138331024 16:56215275-56215297 TCATCTCTATGGGACCTTGAGGG - Intronic
1142105213 16:88299014-88299036 TCATCTGTGTGGGGCTCTGGAGG - Intergenic
1142468051 17:147207-147229 TCAGCTCTCTGGGGCCCAAGAGG - Exonic
1142494010 17:296647-296669 TCACCTCTGAGGGGCTGTGGGGG + Intronic
1143152604 17:4816761-4816783 TCAGCTCTCTGGGGCTTTGGCGG - Intronic
1146314538 17:31796817-31796839 TCAGCCCTATAGGGCCCTGTAGG - Intergenic
1149905218 17:60520031-60520053 TCAGCACTTTGGGGCCATGGTGG - Intronic
1151993661 17:77595085-77595107 TCACCTCCCTGGGGCTCTGCTGG + Intergenic
1152294574 17:79459224-79459246 TCACCTCTATGGGGCCCTGGAGG + Intronic
1152781858 17:82230325-82230347 TCCACACCATGGGGCCCTGGGGG - Intronic
1152851197 17:82637214-82637236 ACATCTCTAAGGGTCCCTGGCGG + Intronic
1155276275 18:24190435-24190457 TTCCCTCTCTGGTGCCCTGGAGG - Intronic
1161443625 19:4305711-4305733 TCTCCTCTCTGGATCCCTGGAGG + Intronic
1161563387 19:4986077-4986099 TCCCCTCTCTGGTGCCCCGGGGG + Intronic
1162027196 19:7901042-7901064 TCATCTTTCTGGGGCCCAGGAGG + Exonic
1165443358 19:35843552-35843574 TCACCTCAGTGGGGTCCTGGAGG + Exonic
1165745239 19:38226704-38226726 TGGCCACTATAGGGCCCTGGAGG - Intronic
1165751840 19:38264952-38264974 GCTCCTCTCTGGGGTCCTGGCGG + Exonic
1166275670 19:41752143-41752165 TCACCTCAAAGTGGCCCTTGGGG - Intronic
1166922204 19:46236763-46236785 TCCCCTATATGGGGCCCAGAAGG - Intergenic
925589243 2:5493552-5493574 TTTCCTCTCCGGGGCCCTGGAGG + Intergenic
926115516 2:10210581-10210603 TGCTGTCTATGGGGCCCTGGGGG - Exonic
926625717 2:15088063-15088085 CCACATAAATGGGGCCCTGGAGG + Intergenic
929583807 2:43101259-43101281 TGATTTCCATGGGGCCCTGGAGG + Intergenic
934175979 2:89581092-89581114 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
934286289 2:91655454-91655476 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
946047678 2:216834758-216834780 TCTCCTCTATGGCTCCCTTGTGG + Intergenic
946596332 2:221309776-221309798 TCGCCTCTGTGGGACCCTGCAGG + Intergenic
947270811 2:228332715-228332737 TCATCTCTCTGGGCTCCTGGTGG + Intergenic
948245589 2:236481455-236481477 TTACCTCTCTGTGGCCCTGGAGG + Intronic
948556493 2:238814778-238814800 CCTCCTCTATGGGGCTCTGGTGG + Intergenic
948809070 2:240465812-240465834 GCACCTCTGCGGCGCCCTGGAGG + Intronic
1170158034 20:13286266-13286288 GCACCTCTCTGGTGCCCTTGGGG + Intronic
1170164268 20:13345478-13345500 TAACCTCCATGGGGGACTGGGGG + Intergenic
1170935070 20:20802804-20802826 TCAACTTGATGGGACCCTGGGGG - Intergenic
1172613620 20:36268917-36268939 GCCCCTCTATGGAGGCCTGGAGG + Intronic
1172882908 20:38213298-38213320 TCCCCTCTGGGGGGCCCAGGAGG + Exonic
1175308193 20:57992443-57992465 TCACCTCCCTGGGTTCCTGGAGG + Intergenic
1175947428 20:62565412-62565434 TCACCCCTGTGGGTCCCTGGAGG - Intronic
1176261874 20:64186153-64186175 TCACTTTTATGGGGCTCTTGTGG - Intronic
1176869736 21:14075197-14075219 GCACCTCTCTGCGGCCATGGGGG - Intergenic
1176901229 21:14444558-14444580 TCATCTCTTTGAGTCCCTGGTGG + Intergenic
1179501658 21:41813034-41813056 TCACGTCTGGGGGGCTCTGGGGG + Intronic
1181407316 22:22694260-22694282 TAACCTCTTTGGGTCCCTTGGGG + Intergenic
1181415315 22:22755029-22755051 TAACCTCTTTGGGTCCCTTGGGG + Intronic
1181462754 22:23095086-23095108 TCTCCTCCATGGGGCGCTGTAGG - Intronic
1183069544 22:35386705-35386727 CCACATCTATGTGGCCCTGGAGG + Exonic
949891696 3:8738105-8738127 TCACTGCTTTAGGGCCCTGGGGG - Intronic
950787031 3:15445446-15445468 TCACCTCTTTGGGGATCTAGGGG - Intronic
950961683 3:17114739-17114761 TCACCTCTCTGGGACCCAAGGGG - Intergenic
951066374 3:18271260-18271282 CCACCTCTATGGAGTCCTTGAGG + Intronic
951558718 3:23945566-23945588 TCACCTCCATGGTGCCCTCGCGG - Exonic
953246734 3:41199878-41199900 CTGCCTCTCTGGGGCCCTGGGGG + Intronic
953392157 3:42540060-42540082 TCATCTCTATCGCCCCCTGGTGG + Intergenic
954717248 3:52533021-52533043 ACACCTCGATGTCGCCCTGGAGG - Intronic
957048606 3:75395214-75395236 GCAGCTCTATGGAGGCCTGGTGG - Intergenic
961726671 3:128935234-128935256 CCGGCTCTATGGGGACCTGGAGG - Exonic
966430515 3:179827335-179827357 ACACCTCCATGGGGCCTTTGAGG - Intronic
968594862 4:1477080-1477102 TCCCCTCTAAGAGCCCCTGGAGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969509844 4:7611553-7611575 TCACCTTCAGGGGGCCCTGAAGG - Intronic
969627100 4:8311204-8311226 TCTCCTCTAAGGAGCCATGGAGG - Intergenic
978311708 4:107391428-107391450 TGACCTCTATAGATCCCTGGGGG - Intergenic
980107579 4:128602253-128602275 TCACCACTTTGGGGAGCTGGTGG + Intergenic
980911715 4:139000118-139000140 TCACCTCTGTGGAGCCATGTGGG - Intergenic
988263888 5:28926842-28926864 GCAGCTCTATGGAGGCCTGGCGG - Intergenic
991247465 5:64523179-64523201 TCACCTACCTGGGGCCCTGCTGG - Intronic
992029871 5:72710404-72710426 TCACCTACATAGGGCCCAGGGGG - Intergenic
992655027 5:78900562-78900584 CCACTTCTCTGTGGCCCTGGGGG + Intronic
1002416881 5:179125417-179125439 TCACCACTGGGAGGCCCTGGTGG + Intronic
1002496280 5:179614010-179614032 ACTCGTCTTTGGGGCCCTGGTGG - Intergenic
1005317903 6:24621971-24621993 CTACCTCCATGGGGCCCTGGTGG + Intronic
1005923373 6:30419253-30419275 CCAGCTGTATGGTGCCCTGGTGG - Intergenic
1006798692 6:36746089-36746111 TCACTTTTCTGGGGCCCTGAGGG + Intronic
1009812561 6:68688012-68688034 TTATCTCTATGTGGCCCTTGAGG + Intronic
1014719532 6:124899023-124899045 TGTGGTCTATGGGGCCCTGGGGG + Intergenic
1018928425 6:168222976-168222998 CTACCTCGATGAGGCCCTGGCGG - Intergenic
1019525283 7:1477913-1477935 TCACCTCGATCAGCCCCTGGAGG + Exonic
1019716391 7:2541358-2541380 CCACCTCTGTGGGACCCTGGCGG - Exonic
1019777889 7:2923294-2923316 TCACCTCTGTGGGGCACGTGCGG - Exonic
1020413451 7:7918311-7918333 TTAACTCTTTGGGGCCCTTGGGG + Intronic
1020455761 7:8372232-8372254 TCATCTCTCAGGGGTCCTGGGGG - Intergenic
1020736658 7:11957809-11957831 TTCTCTCTATGGGGCTCTGGAGG + Intergenic
1022488378 7:30797962-30797984 CCACATCTGTGGGCCCCTGGAGG + Intronic
1024510692 7:50202331-50202353 TCACATCTATGTGGCCCTAAAGG - Intergenic
1028889779 7:95974077-95974099 TCACCTCATTGTGGCCTTGGTGG + Intronic
1033062526 7:138122330-138122352 GCAGCTCCATGGGGCCCTGGCGG + Intergenic
1033257941 7:139818164-139818186 TCATCTCTGGGAGGCCCTGGAGG + Intronic
1033566245 7:142580934-142580956 TCACCTAGATGAGGCCCTTGTGG - Intergenic
1035320543 7:158026698-158026720 GCACCTCTGTGGGGCTCAGGGGG - Intronic
1035855384 8:2970211-2970233 TCACCTCTGTGGGGCTATGAAGG - Intronic
1036473797 8:9074936-9074958 TCACCTCACTGTGGCGCTGGTGG - Intronic
1037584457 8:20267163-20267185 TCACCTCTCAGGCACCCTGGTGG + Intronic
1040278928 8:46028035-46028057 GCACCTCTCTGTGGCCATGGTGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045383361 8:101648248-101648270 TCACGTCTGTGGGACCCTGGGGG + Intronic
1047400156 8:124539322-124539344 CCACCTCCATGGGGCCCCGAGGG - Intronic
1047754100 8:127905363-127905385 CCACCTGTGTGGTGCCCTGGGGG + Intergenic
1048043496 8:130752476-130752498 TCAGATCACTGGGGCCCTGGGGG + Intergenic
1048167521 8:132076576-132076598 TCTCTTCTAGGGGGCCCTGAGGG + Intronic
1049920028 9:354617-354639 TCACCTCAAGGGTCCCCTGGGGG + Intronic
1053715380 9:40883646-40883668 GCAGCTCTATGGAGGCCTGGTGG - Intergenic
1054077167 9:60547088-60547110 GCAGCTCTATGGAGGCCTGGTGG + Intergenic
1058877831 9:109259519-109259541 TCAGCTCTAGGAGGCCGTGGAGG + Intronic
1059677486 9:116553325-116553347 TCACCTCTAAAGAGCCCTAGCGG + Intronic
1060296705 9:122348079-122348101 TAACCTCTCTGGGCCCCTGTGGG - Intergenic
1061803155 9:133123141-133123163 TCACCTCTTTGTGGCCCTGTGGG - Intronic
1062459262 9:136656033-136656055 TCCCCTCTGGGGGGCTCTGGGGG + Intergenic
1188416803 X:29945132-29945154 TCTCCTCTCTGTGGCCCTGAGGG + Intronic
1191065660 X:56344094-56344116 TTAGCTCTATGGGGCCAAGGTGG - Intergenic
1191249873 X:58255155-58255177 TCCCCTCTGTTGGGCCCTTGGGG - Intergenic
1199635070 X:149806316-149806338 CCACCTCTCTGGGGCCTGGGAGG - Intergenic
1199678443 X:150207309-150207331 TCACCTCTTTGGGCCCCATGTGG - Intergenic