ID: 1152294766

View in Genome Browser
Species Human (GRCh38)
Location 17:79460389-79460411
Sequence TGACTGTGGTGGGAGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 763
Summary {0: 2, 1: 3, 2: 5, 3: 75, 4: 678}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152294766_1152294775 24 Left 1152294766 17:79460389-79460411 CCACCACACTCCCACCACAGTCA 0: 2
1: 3
2: 5
3: 75
4: 678
Right 1152294775 17:79460436-79460458 GTCTAGCTCTCCCTCCCTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 282
1152294766_1152294771 2 Left 1152294766 17:79460389-79460411 CCACCACACTCCCACCACAGTCA 0: 2
1: 3
2: 5
3: 75
4: 678
Right 1152294771 17:79460414-79460436 TCCCCAGAATCAAGCTCATCAGG 0: 1
1: 0
2: 0
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152294766 Original CRISPR TGACTGTGGTGGGAGTGTGG TGG (reversed) Intronic
900126479 1:1071062-1071084 GGACTGTGGGGAGAGAGTGGAGG - Exonic
900945539 1:5829409-5829431 TGACTGTGCCGAGGGTGTGGTGG + Intergenic
900985889 1:6072651-6072673 TGACTGTTGGGGGAGTGGGTGGG + Intronic
902681895 1:18049597-18049619 TGATGGTGCTGGTAGTGTGGTGG + Intergenic
903283223 1:22262054-22262076 GGGCTGTGGTGGGAGGATGGAGG + Intergenic
903968887 1:27106398-27106420 TAAATGTGATGGGTGTGTGGGGG + Intronic
904497271 1:30893970-30893992 TGTGTGTGGTGTGTGTGTGGAGG - Intronic
904500900 1:30912354-30912376 TGACTGGGGTGGGGGTGAGGTGG - Intergenic
904657849 1:32062706-32062728 GGACTGGGGTGGGAGTGTGGAGG + Intergenic
904876848 1:33661929-33661951 TGTGTGTGGTGGGAGGGAGGGGG - Intronic
904880798 1:33695384-33695406 TCACTGTGGTGGCAGTATGATGG + Intronic
905192434 1:36245840-36245862 TGATTTTGGTGGGTGTGGGGAGG - Intronic
905269413 1:36777278-36777300 TGACTGAGGTGGGCATGTGCAGG + Intergenic
905461965 1:38127935-38127957 GGACAGTGGCGGGAGTGTTGTGG + Intergenic
905626534 1:39493247-39493269 TGTCTGTGGAGGGAGGCTGGTGG - Intronic
905826238 1:41027994-41028016 GGACTGAGGAGGGAGAGTGGGGG - Exonic
905871970 1:41409644-41409666 GGCCTCTGGTGGGAGTGTGTGGG + Intergenic
905893137 1:41529451-41529473 TGAGTTTGGGGGGAGTGTGAGGG - Intronic
906218937 1:44062021-44062043 TTACTGAGGTGGCAGTGTGGTGG - Intergenic
906698253 1:47839346-47839368 TGTGTGTGGTGGGAGTGAGGGGG - Intronic
907078379 1:51598443-51598465 TGTGTGTGGTGGTAGTGGGGTGG + Intronic
907286052 1:53380424-53380446 GGAATGTGGAGGGAGTGTGTGGG + Intergenic
907335642 1:53697657-53697679 GGACTGTGGAAGGAGTGTGATGG - Intronic
907427800 1:54391876-54391898 TGATTGAGGTGGGTGGGTGGAGG - Intronic
907445137 1:54502691-54502713 GGAGTGTGGTGGGGATGTGGGGG - Intergenic
907692107 1:56679438-56679460 AGGGTGTGGTGGGAGAGTGGAGG + Intronic
907701008 1:56788394-56788416 AGATTGTGGTGGGAGTGGTGAGG + Intronic
907887492 1:58606843-58606865 CCACTGTGGTGGGTGGGTGGTGG + Intergenic
908631674 1:66116417-66116439 TGTGTGTGGTGGGAGTTGGGGGG - Intronic
909192439 1:72571457-72571479 TGACTGGATTGGGAGTGTGTGGG - Intergenic
909305011 1:74062830-74062852 TGAAGGTGGTGGGTGTGAGGAGG + Intronic
910696519 1:90024151-90024173 TGACAGTGGAGGGACAGTGGAGG - Intronic
910875748 1:91876098-91876120 GGGGTGTGGTGGGGGTGTGGTGG + Intronic
912736174 1:112151377-112151399 TGGGTGGGGTGGGAGTGGGGAGG + Intergenic
913971744 1:143422122-143422144 TGAGGGTGGTGGGGGTGTGCTGG - Intergenic
914228046 1:145738267-145738289 TGATTCTGGTGGGAGTGGGAAGG - Intronic
914836805 1:151213734-151213756 TGTGTGTGTGGGGAGTGTGGTGG + Intronic
915071794 1:153275417-153275439 GGATGGTGGTGCGAGTGTGGTGG - Intergenic
915089961 1:153417363-153417385 TGGATGGGGTGGGAGTGAGGTGG - Intronic
915300178 1:154947286-154947308 TGACTATAGTGGGAGAGGGGAGG + Intronic
915300668 1:154949803-154949825 TGACTATAGTGGGAGAGGGGAGG + Intronic
917745606 1:178003828-178003850 TGTTTGTGGAGGGAGTGTGGAGG + Intergenic
917922105 1:179759287-179759309 TCAATGTGATGGGAGTGGGGAGG - Intronic
918107183 1:181425277-181425299 GGACTGCGGTGGGAGTCTCGGGG - Intronic
918425716 1:184407687-184407709 TGACTTTTGTGGGGGAGTGGTGG + Intronic
918579790 1:186112507-186112529 AGACTCTGCTGGGAGTGTCGGGG - Intronic
919194928 1:194272150-194272172 GGACTGTGGTGGGGAGGTGGGGG - Intergenic
919662489 1:200260844-200260866 TGCCTGTGGTGGGAGGGGAGAGG + Intergenic
919819721 1:201465560-201465582 TGAAGGTGGTGGGGGTGAGGGGG - Exonic
920053030 1:203174921-203174943 GGAATGGGGTGGGGGTGTGGGGG - Intronic
920282611 1:204855481-204855503 AGACTGTGGTGGGAATGGGGTGG + Intronic
920436965 1:205953300-205953322 AGACTGGGGTGGGGGTGGGGTGG + Intergenic
921608018 1:217177856-217177878 TGAATGTGGTGGGAGTAAGGTGG + Intergenic
921777964 1:219125023-219125045 TGACTCTGGTGGTAATATGGAGG - Intergenic
922618756 1:226978221-226978243 TGTGTGTGGTGGGTGTGTAGAGG - Intronic
922618830 1:226978544-226978566 TGGCTGTGGGGGGTGTGTGGAGG - Intronic
922618912 1:226978920-226978942 GGTGTGTGGTGGGTGTGTGGAGG - Intronic
922882014 1:228988218-228988240 TGCCTGTGCTGGCATTGTGGAGG + Intergenic
923053927 1:230410933-230410955 TGAGTGTGGTGGGGGTGGTGAGG + Intronic
923251902 1:232185634-232185656 TGGCTGTAGTTGGGGTGTGGTGG - Intergenic
923718862 1:236450252-236450274 TGGCCCAGGTGGGAGTGTGGTGG - Intronic
923789407 1:237099275-237099297 TGACTCAGGCTGGAGTGTGGTGG + Intronic
924032081 1:239895817-239895839 TGAGTGTGGAGGGTGGGTGGAGG + Intronic
924668409 1:246097616-246097638 AAACTGGGGTGGGATTGTGGGGG - Intronic
1062795977 10:345556-345578 TGTCTGGGTTGGGGGTGTGGGGG - Intronic
1064401871 10:15028253-15028275 AGGCTGAGGTGGGAGTGTAGCGG - Intergenic
1065147211 10:22781570-22781592 TTACAGTGGTAGAAGTGTGGTGG + Intergenic
1066027025 10:31368805-31368827 TGGCTGTGGTGGTGGTATGGTGG + Intronic
1066449195 10:35512582-35512604 TGAATGGGGAGGGAGTGTGGAGG + Intronic
1067440351 10:46305730-46305752 TCATTTTTGTGGGAGTGTGGTGG - Intronic
1067534203 10:47096099-47096121 TGGCTGGTGTGGGAGTGGGGCGG - Intergenic
1067686339 10:48468149-48468171 GGAATGTGGTGGGATTGGGGTGG - Intronic
1068159469 10:53245283-53245305 TGATTTTGGTGGGTGTGGGGAGG + Intergenic
1068359275 10:55954578-55954600 TGGCTGTGATTGAAGTGTGGGGG - Intergenic
1068637446 10:59362921-59362943 GGGGTGGGGTGGGAGTGTGGGGG - Intronic
1068843430 10:61642163-61642185 TGATTGTGGTGTGTGTGTGTTGG - Intergenic
1069416183 10:68202855-68202877 TGTGTGTGTTGGGATTGTGGGGG + Intronic
1069546046 10:69329739-69329761 AGACTGGGGTGGGAGAGGGGTGG + Intronic
1069604608 10:69731554-69731576 TGATGGTGGAGGGGGTGTGGTGG + Intergenic
1069813233 10:71177973-71177995 TGAGTGGGGTGGGGGTGTGGTGG - Intergenic
1070528404 10:77314910-77314932 TGTGTGTGTTGGGGGTGTGGTGG - Intronic
1070556165 10:77529330-77529352 TGGCTGAGGTGGGAGGGTGCTGG - Intronic
1070580359 10:77714379-77714401 TGACGGTGGTGGGAGGCAGGGGG - Intergenic
1070679599 10:78439339-78439361 TGAGTGTGGTGGGAGTGGGGAGG + Intergenic
1073051213 10:100668564-100668586 AGTGTGTGGTGGGGGTGTGGGGG - Intergenic
1073325650 10:102642955-102642977 TGGCTGTGATGAGAGTGTTGGGG + Intergenic
1074417094 10:113276279-113276301 TGGCACTGGTGGGAGTGTAGTGG + Intergenic
1074862208 10:117518992-117519014 TGACTGTGCTGGGGCAGTGGAGG - Intergenic
1075174326 10:120145150-120145172 TGACCTGGGTGGGAGTGTGTGGG + Intergenic
1075198617 10:120382772-120382794 TGAATGAGGTGGGTGGGTGGGGG - Intergenic
1075342952 10:121661779-121661801 GGACTCTGGAGGGAGCGTGGAGG + Intergenic
1075595937 10:123729100-123729122 TGACTGCAGTGGGAGGGTGGGGG - Intronic
1075649979 10:124121087-124121109 TGTCTGTGGTGTGTGTATGGGGG + Intergenic
1076005307 10:126944121-126944143 TGATGGTGGTGGGGGTGGGGAGG + Intronic
1076351150 10:129816068-129816090 TGGCTGTGGTGGCTGTGGGGAGG - Intergenic
1076677526 10:132154908-132154930 TGACGGTGGTGGTAGTGGGATGG + Intronic
1076738432 10:132468816-132468838 GGACAGTGGTGGGGGTGTTGGGG + Intergenic
1076745645 10:132512091-132512113 TGACAGTGGTGAGAGTGTGTAGG + Intergenic
1077077730 11:708958-708980 GGGATGAGGTGGGAGTGTGGGGG - Intronic
1077097090 11:803689-803711 TGGCTGGGGTGGGGGTGGGGTGG - Intronic
1077184433 11:1229928-1229950 CGCCTGCGGTGGGGGTGTGGAGG + Intronic
1077221322 11:1418779-1418801 TGCCTGTGTTGGGCATGTGGGGG + Intronic
1077511805 11:2969443-2969465 TTCCTGTGGTGTGAGTGTGCAGG - Intronic
1078088945 11:8251900-8251922 AGTGTGTGGTGGGTGTGTGGTGG + Intronic
1078368879 11:10728850-10728872 GGGCTGGGGTGGGAGTGAGGTGG + Intergenic
1078437962 11:11340977-11340999 GCAGTGTGGCGGGAGTGTGGAGG - Exonic
1078556800 11:12334604-12334626 GGACTGTTGTGGGGGGGTGGGGG - Intronic
1078749062 11:14142922-14142944 TGACACTGGGGGCAGTGTGGAGG - Intronic
1079153692 11:17924581-17924603 GCACTGTGGTGGCAGTGTGGAGG + Intronic
1079211935 11:18469387-18469409 AATCTGTGGTGGGAGTGTGGTGG - Intronic
1079548771 11:21669198-21669220 GGACTGTTGTGGGGTTGTGGGGG - Intergenic
1079868892 11:25770591-25770613 GGACTATGGTGGGAGTGGGTAGG - Intergenic
1079915982 11:26369167-26369189 TGTGTGTGTTGGAAGTGTGGAGG + Intronic
1079951386 11:26809420-26809442 GGCCTGTCATGGGAGTGTGGGGG - Intergenic
1079994930 11:27286044-27286066 TGACAGCTGTGGGAGTATGGAGG + Intergenic
1080411335 11:32028112-32028134 TGACTGTGCTCCCAGTGTGGAGG + Intronic
1080547607 11:33336381-33336403 TTACTATGGTGGGAGTTTGGAGG - Intronic
1080686841 11:34523072-34523094 TGTCTGTGGGGAGAGTGTGGTGG - Intergenic
1081766584 11:45615552-45615574 TGACGCTGGTGGGTGTTTGGAGG - Intergenic
1083071279 11:59984971-59984993 TGACTGTAGTGAGAGTGTGTAGG - Intergenic
1083288263 11:61674909-61674931 TGACAGTGATGGCAGTTTGGTGG - Intergenic
1083518463 11:63283325-63283347 TGACAGTGGTGGCAGTGAGTGGG + Intronic
1083641279 11:64146655-64146677 GGGATGTGGTGGGAGTGAGGTGG - Intronic
1083890862 11:65595228-65595250 TGCCTGGGGTGGGACTGGGGAGG + Intronic
1084188675 11:67488992-67489014 TGTCTGTGGTGGGGGTGAGGAGG + Intronic
1084320775 11:68372333-68372355 GGACTGTGGTGGTGGTGAGGAGG + Intronic
1085265137 11:75233154-75233176 TGTTGGTGGTGGGAGAGTGGGGG - Intergenic
1085343993 11:75754472-75754494 GGACTGTGGTGGGGTGGTGGGGG + Intergenic
1085507310 11:77067664-77067686 TGTGTGTTGCGGGAGTGTGGGGG + Intronic
1086140655 11:83495166-83495188 TGACAGTGGTGGCAGTGGGCAGG + Intronic
1086181915 11:83962376-83962398 TCACTCTGGAGGGAGTTTGGGGG + Intronic
1087529193 11:99357479-99357501 TGTGTGTGGTGGGGGTGGGGAGG - Intronic
1088325282 11:108594268-108594290 TGACTTTTGTGGGACAGTGGAGG - Intergenic
1088843403 11:113645060-113645082 TGGGTGTGCTGGGAGTGAGGTGG + Intergenic
1089532267 11:119138061-119138083 TGGCTGGGGAGGGAATGTGGAGG + Intergenic
1089632030 11:119789837-119789859 AGACTGTGGTGGGCCTTTGGGGG - Intergenic
1089670817 11:120055905-120055927 TTCCTGGGGTGGGAGTGAGGAGG - Intergenic
1089748911 11:120636499-120636521 AGACTGTGTTGGGAGTCTTGGGG + Intronic
1090176771 11:124656930-124656952 TCTCTGTGGTGGGTGGGTGGGGG - Intronic
1090257095 11:125292443-125292465 TGGGTGGGGTGGGAGTGAGGGGG + Intronic
1090427833 11:126621955-126621977 TGACAGTGGTGGGAGTCTGGGGG + Intronic
1090620180 11:128553678-128553700 GGAGGGTGGCGGGAGTGTGGAGG - Intronic
1090988595 11:131795777-131795799 TGACTGGGGTTGGGGGGTGGTGG + Intronic
1091091031 11:132771555-132771577 TGAGTGTGGTGGGAGCCTCGTGG - Intronic
1091469261 12:712733-712755 TGACGGTGGTTGGCGGGTGGTGG + Intergenic
1092203201 12:6600045-6600067 AGACTGCGGTGGGCGGGTGGGGG - Intronic
1092278909 12:7085084-7085106 TGATGGTGGTGTTAGTGTGGTGG + Intronic
1092280071 12:7091904-7091926 GGAGTGTGAGGGGAGTGTGGTGG - Intronic
1092507885 12:9123450-9123472 TGACTGGGGTGGGGGTTAGGGGG + Intergenic
1092731863 12:11542330-11542352 TCACTGAGGTTGGAGTGTAGTGG + Intergenic
1093506191 12:19869586-19869608 TGACCGGGGTGGGGGTGTGTGGG + Intergenic
1094063032 12:26334756-26334778 TGCATGTGGGGGCAGTGTGGTGG - Intergenic
1094177206 12:27553265-27553287 TGACAGTGGTGGCATTGTTGAGG - Intronic
1094207179 12:27852978-27853000 TGACTGTTGTGGGAGTGTGGGGG - Intergenic
1094596546 12:31871525-31871547 TCACTGTGGTGGGAGGATCGCGG - Intergenic
1095476472 12:42590928-42590950 TGTGTGTGGGGGGAGTGTGGAGG + Intergenic
1095620156 12:44243783-44243805 TGCCAGAGGTGGGAGGGTGGGGG - Intronic
1096037205 12:48482794-48482816 TGACTGAGGTGGGAGGGGGTGGG + Intronic
1096761589 12:53846079-53846101 TGACTGCAGTGGGAGGGTGGTGG - Intergenic
1096861656 12:54533097-54533119 TGACTGTGGGGGCAGTGAGGGGG + Intronic
1097666105 12:62479026-62479048 TGGCTGAGGTAGGAGTTTGGGGG + Intronic
1097971754 12:65640482-65640504 TGATGGTGGTGAGAGGGTGGAGG - Intergenic
1098347755 12:69524210-69524232 TGACAGTGGTGGTATGGTGGGGG + Intronic
1098612820 12:72482656-72482678 TGGCAGTGGTGGTAGTATGGTGG + Intronic
1099616814 12:84946456-84946478 TGTCTGGGATGGGAGTGGGGAGG + Intergenic
1100712802 12:97275846-97275868 AGTCTGGGGTGGGAGTGGGGAGG - Intergenic
1102071523 12:110023852-110023874 TAACTGTGGGAGGAGGGTGGAGG + Intronic
1102520787 12:113476569-113476591 TGGCGGGGGTGGGAGTGGGGTGG + Intergenic
1102563329 12:113778432-113778454 TGTGTGTGGTGGGAGAGGGGTGG + Intergenic
1102867923 12:116388949-116388971 TGTGTGTGGCGGGAGGGTGGAGG - Intergenic
1103551767 12:121743132-121743154 TGACTGTGTCTGGAGTGGGGAGG + Intronic
1103637150 12:122316493-122316515 TGACTTTGGGGTGGGTGTGGTGG - Intronic
1104259984 12:127173397-127173419 TGACTGTGGTTAGAGTGGGGAGG + Intergenic
1104290152 12:127458921-127458943 AGACTATGGTGGAAGTGCGGTGG + Intergenic
1104639462 12:130458111-130458133 TGCCTGTGGAGGGATAGTGGGGG - Intronic
1104965286 12:132506186-132506208 TGACTGTGGCCGGGGTGGGGAGG + Intronic
1105008630 12:132739103-132739125 TGAGGGTGGAGGGAGTGAGGAGG + Intronic
1105718384 13:23090284-23090306 AGACTGTTGTGGGTGTGTGTTGG - Intergenic
1105947520 13:25202462-25202484 TGCCTGTGGTGACAGTGTGGTGG - Intergenic
1106563071 13:30863301-30863323 TGGCTGGGGTGGGGCTGTGGAGG - Intergenic
1108024116 13:46160797-46160819 TAAGTGGAGTGGGAGTGTGGGGG + Intronic
1108530913 13:51326180-51326202 TGACTCTGGTGGCAGTGGGGTGG - Intergenic
1108636846 13:52343881-52343903 GGGCTGTGGTGGGGGTGGGGGGG - Intergenic
1109335681 13:60990914-60990936 TATCAGAGGTGGGAGTGTGGGGG - Intergenic
1109341108 13:61060319-61060341 TCACTGTGGCTGGAGTGTAGTGG + Intergenic
1110395501 13:75025328-75025350 TCACTAAGGTTGGAGTGTGGTGG - Intergenic
1111683292 13:91470063-91470085 AACCTGTGGTGGGAGTGGGGAGG - Intronic
1112219392 13:97472359-97472381 TTATTCTGGTGGGAGCGTGGTGG + Intergenic
1112537539 13:100274921-100274943 GGACTGGGGTGGGTGAGTGGGGG + Intronic
1112767740 13:102763565-102763587 TGACTGGGTTGGGAGTGGCGGGG - Intergenic
1112796428 13:103061433-103061455 AGAGTGTGGTGGGAATCTGGTGG + Intronic
1113263539 13:108592407-108592429 TGTGTGTGGTGTGTGTGTGGAGG + Intergenic
1113571544 13:111361668-111361690 TGACTGTGGAGGAAATGTAGAGG + Intergenic
1113786651 13:113005453-113005475 TGACTGTGGTCTGTTTGTGGTGG + Intronic
1114017515 14:18444676-18444698 AGACTGTCGTAGCAGTGTGGTGG + Intergenic
1114307415 14:21436863-21436885 CGACTGGGGTGGGGGTGGGGGGG + Intronic
1114520817 14:23334338-23334360 TCACTGAGGCTGGAGTGTGGTGG + Intergenic
1114651292 14:24286244-24286266 GGACTATTGTGGGACTGTGGTGG - Intergenic
1114686917 14:24541776-24541798 TAAGTGTGGAGGGAGGGTGGAGG + Intergenic
1115035799 14:28854881-28854903 TGACTGTGGTGATAGTTTGTTGG - Intergenic
1115122199 14:29951054-29951076 GGAGGGTGGTGGGAGTGGGGAGG - Intronic
1115835441 14:37397369-37397391 TGGAGGTGGTGGGAGTGGGGAGG + Intronic
1116282586 14:42928185-42928207 TGACTCTGTTGGGAGAGTGGGGG + Intergenic
1116428244 14:44816274-44816296 TGATTCTGGTGTGTGTGTGGAGG - Intergenic
1117793427 14:59365169-59365191 TGACTGGGGTGTGTGTGTGTAGG + Intronic
1119064838 14:71514604-71514626 TAACTTTCCTGGGAGTGTGGGGG + Intronic
1119165034 14:72485600-72485622 TGAAGGTGATGGGAGTGTGAAGG - Intronic
1119474217 14:74917909-74917931 TGAGTGTGGTGGGGGTGCTGTGG + Intronic
1119532740 14:75374289-75374311 TCACTGGAGTGGGAGTGGGGAGG + Intergenic
1120711007 14:87793247-87793269 GGAACGTGGTGGCAGTGTGGAGG + Intergenic
1121157056 14:91695727-91695749 TCACTCTGGTGGGTGTATGGAGG + Intronic
1121608441 14:95258763-95258785 TATCTGTGGTGTGTGTGTGGAGG + Intronic
1121608452 14:95258874-95258896 TATCTGTGGTGTGTGTGTGGAGG + Intronic
1122043237 14:99005275-99005297 GGCCTGTTGTGGGAGGGTGGCGG + Intergenic
1122191160 14:100044833-100044855 TCACTTTGGTGGGAGCTTGGAGG + Intronic
1122657394 14:103271391-103271413 TGTGTGTGGGGGGGGTGTGGGGG - Intergenic
1122824375 14:104362488-104362510 GGCCTGTGGAGGGGGTGTGGGGG + Intergenic
1123034446 14:105466265-105466287 TGACTGGGCTGGAAGTGGGGAGG - Intronic
1202833772 14_GL000009v2_random:62750-62772 GTACGGTGGTGGGAGGGTGGTGG + Intergenic
1124387063 15:29218259-29218281 TGGCTGTGGTGGGTGTGGAGAGG + Intronic
1125317623 15:38448231-38448253 TCACGGTGGTGGGACTTTGGTGG + Intergenic
1125673171 15:41487814-41487836 TGTGTGTGGTAGGAGTGGGGAGG - Intergenic
1125791234 15:42367308-42367330 GAACTGTGGTGGGAGTGAGGAGG + Intronic
1126144481 15:45462977-45462999 TGATGGTGGTGGTGGTGTGGTGG - Intergenic
1126144519 15:45463123-45463145 TGATGGTGGTGGTGGTGTGGTGG - Intergenic
1126195185 15:45923316-45923338 TGATGGTGGTGGAGGTGTGGAGG + Intergenic
1126348411 15:47719149-47719171 TGGCGGGGGTGGGGGTGTGGAGG + Intronic
1126678851 15:51184994-51185016 TGGCTGTGGGTGGAGGGTGGGGG + Intergenic
1126726578 15:51638008-51638030 TGTTTGAGGTGGGCGTGTGGTGG - Intergenic
1127009070 15:54602740-54602762 TCACTTTGGAGGGAGGGTGGGGG - Intronic
1127313426 15:57772231-57772253 TGACTCTGGTGGCAAAGTGGAGG - Intronic
1127331748 15:57946721-57946743 TGTTTGTGTTGGGTGTGTGGGGG + Intergenic
1127905641 15:63373963-63373985 TTACAGTGGTGGCAGTGAGGGGG - Intronic
1128454266 15:67823781-67823803 TGGCAGTGGTGGGAGCGAGGCGG - Intronic
1129322081 15:74781022-74781044 TGACAGGGGTGGGAGAGTGCAGG - Intergenic
1129561462 15:76575229-76575251 TGGCAGGGGTGGGGGTGTGGGGG + Intronic
1129698808 15:77755804-77755826 GGAAGGAGGTGGGAGTGTGGGGG - Intronic
1130085485 15:80775288-80775310 TCGCTGTGGCTGGAGTGTGGTGG - Intergenic
1131225921 15:90624336-90624358 TCACTGTGGTTCCAGTGTGGAGG - Intronic
1131819797 15:96260743-96260765 TGCCTGTGTTGGCAGTTTGGTGG - Intergenic
1131832878 15:96365595-96365617 TTACTGTGGACGGAGTGGGGTGG - Intergenic
1132047033 15:98572731-98572753 TGGCAGTGGTGGGAGCCTGGTGG - Intergenic
1132555763 16:571779-571801 AGGCTGAGGTGGGAGTGTGATGG + Intronic
1132732077 16:1367528-1367550 TGACTCAGGTGAGCGTGTGGGGG - Intronic
1133321230 16:4914916-4914938 TGACTGGGGTGGGAGTGTGGGGG - Intronic
1135656306 16:24253446-24253468 TGAACGGAGTGGGAGTGTGGAGG - Intergenic
1135750979 16:25058831-25058853 TGAGTGTGGTGGGGACGTGGGGG - Intergenic
1135828982 16:25756318-25756340 TCACTCTGGTGGCAGTGAGGAGG + Intronic
1136250412 16:29000829-29000851 TGATAGTGGTTGGAATGTGGTGG - Intergenic
1136267963 16:29131949-29131971 TGGGTGTGGGGGGAGTGAGGTGG + Intergenic
1136405672 16:30045269-30045291 TGTGTGTGGTGTGTGTGTGGTGG + Intronic
1136505339 16:30699091-30699113 TGGGTGGGGTGGGAGTCTGGAGG + Intronic
1137269601 16:46894535-46894557 TGGCTGTGGGATGAGTGTGGGGG + Intronic
1137284174 16:47001429-47001451 TGGGTGGTGTGGGAGTGTGGGGG + Intergenic
1137691624 16:50432014-50432036 TGATTCTGTGGGGAGTGTGGGGG + Intergenic
1137915439 16:52424815-52424837 TGACAGTGTTGGGTGTTTGGAGG + Intergenic
1138140167 16:54561155-54561177 TGTGTGTGGTGTAAGTGTGGAGG - Intergenic
1138275299 16:55729993-55730015 TGAGGGTGATGGGAGTGAGGTGG + Intergenic
1138280547 16:55769622-55769644 TGAGGGTGATGGGAGTGAGGGGG + Intergenic
1138944675 16:61834264-61834286 TGTGTCTGGTGGGAGGGTGGGGG + Intronic
1139613952 16:68077897-68077919 TCACTGTGGTGGGGGTGGGGGGG - Intronic
1140044355 16:71430892-71430914 TGTGTGTGGTAGGAGGGTGGGGG - Intergenic
1140202418 16:72905196-72905218 TGACTGAGATGGGAGGTTGGGGG + Intronic
1140269841 16:73455803-73455825 TGATTTTGGTTGGAGTGAGGGGG + Intergenic
1141198656 16:81880698-81880720 CGACTGTGGAGGGAATGAGGAGG + Intronic
1141256004 16:82403121-82403143 TGTCTGTGGTGGGTGTTTTGGGG + Intergenic
1142004855 16:87684857-87684879 TGACAGTGGCGGGGGCGTGGAGG + Intronic
1142071270 16:88092287-88092309 TGGGTGTGGGGGGAGTGAGGTGG + Intronic
1143225516 17:5299117-5299139 TGTGTGTGGAGGGGGTGTGGTGG + Intronic
1143299704 17:5900318-5900340 TGACATTGGTGGGTGGGTGGGGG + Intronic
1143396429 17:6602074-6602096 TGATTCTGGTGAGAATGTGGTGG - Intronic
1144137770 17:12314688-12314710 TGGTGGTGGTGGGAGTGTGGGGG + Intergenic
1144146425 17:12403779-12403801 TGCAGCTGGTGGGAGTGTGGGGG - Intergenic
1144599538 17:16600158-16600180 TGAGGGTGGTGGCAGAGTGGAGG + Intergenic
1145954014 17:28842364-28842386 TGATTGCGGGGGGAGGGTGGTGG - Intronic
1146165439 17:30584741-30584763 TGACTGGGGTGAGAGTCTGTGGG + Intergenic
1146798803 17:35801947-35801969 CCACTGGGGTGGGAGTGGGGTGG + Intronic
1146947425 17:36883472-36883494 CCTCTGTGGTGGGAGGGTGGGGG + Intergenic
1147161225 17:38570583-38570605 TGACACTGGTGGCAGGGTGGGGG - Intronic
1148593317 17:48832685-48832707 TGACAGTGTTTGAAGTGTGGTGG - Intronic
1148617736 17:49013602-49013624 TGACTGAGGTGGTCCTGTGGGGG - Intronic
1150122231 17:62613718-62613740 TGAATTTTGTGGGTGTGTGGTGG + Intronic
1151379723 17:73717418-73717440 GGGCTGTGGTGGGAGCCTGGAGG + Intergenic
1151782945 17:76259434-76259456 TAACTGTGCTGGGAGTGGTGCGG + Intergenic
1152085652 17:78216570-78216592 TGCCTGTGGAGGGCGTGGGGAGG + Intronic
1152291551 17:79442757-79442779 AGACTGGGGTGGGGGTGAGGAGG + Intronic
1152294766 17:79460389-79460411 TGACTGTGGTGGGAGTGTGGTGG - Intronic
1152426115 17:80219756-80219778 AGACGGTGGTGGGTGGGTGGTGG + Intronic
1152435728 17:80274819-80274841 TGTCTGTGGGGGGTGAGTGGGGG + Intronic
1152436809 17:80281335-80281357 TGAGTGGGGTGTGTGTGTGGGGG - Intronic
1152658535 17:81531113-81531135 GGACGGTGGTGACAGTGTGGTGG + Intronic
1153387120 18:4510712-4510734 GTGCTGTGGTGGTAGTGTGGTGG + Intergenic
1153387151 18:4510848-4510870 GGTGTGTGGTGGTAGTGTGGTGG + Intergenic
1153779308 18:8479973-8479995 GGACCGGGGTGGGAGTGGGGGGG - Intergenic
1155149637 18:23112705-23112727 TCTCTGTGGAAGGAGTGTGGAGG + Intergenic
1155158998 18:23180832-23180854 TGTCTGTGGTGGGGGGATGGAGG + Intronic
1155684024 18:28524919-28524941 TGACAGTGGTGAGTGTGTAGTGG - Intergenic
1155908946 18:31486778-31486800 AGACTGGGGTGGGGGTGTGATGG - Intergenic
1156367938 18:36446913-36446935 TGACTGGGGTAGCAGTGGGGAGG + Intronic
1156544349 18:37948727-37948749 TGACTGTGGTTGGGGTGTCTGGG + Intergenic
1157239703 18:45997702-45997724 GGACTGGGGTGGGTGGGTGGGGG - Intronic
1157817589 18:50741346-50741368 TTACTGTGGTGGGAATGGGAGGG - Intergenic
1158249869 18:55475847-55475869 TGACCTAGGTGGGAGTGGGGAGG + Intronic
1158311139 18:56159717-56159739 TGACTGTGATGGCAGAGTTGGGG + Intergenic
1159409643 18:68054860-68054882 TGCCCTTGATGGGAGTGTGGGGG - Intergenic
1160551106 18:79694236-79694258 CGGCTGGGATGGGAGTGTGGGGG + Intronic
1160551160 18:79694424-79694446 CGGCTGGGATGGGAGTGTGGGGG + Intronic
1160551191 18:79694520-79694542 CGGCTGGGGTGGGAGTGTGGGGG + Intronic
1160551218 18:79694616-79694638 CGGCTGGGGTGGGAGTGTGGGGG + Intronic
1160832310 19:1109625-1109647 TGAGTGTGGTGGGGGCGGGGTGG + Intronic
1160986835 19:1843074-1843096 ACTCTGTGGTAGGAGTGTGGGGG + Intronic
1161017606 19:1991010-1991032 TGACTGGGGCGGGAGAGTTGGGG + Intronic
1161388690 19:4010192-4010214 TGACACTGGAGGGAGTGCGGGGG - Intronic
1161828490 19:6585913-6585935 GGGTTGGGGTGGGAGTGTGGTGG - Exonic
1161921427 19:7269067-7269089 GGACTGTGGTGTGTGTGTTGGGG - Intronic
1162124178 19:8490439-8490461 TGACCGTGGTGGGGGAGTGCGGG - Intronic
1162181150 19:8869835-8869857 TGCCTGAGGTTGGAGGGTGGCGG + Intronic
1162398854 19:10432621-10432643 TGGCTGTGCTGGGGGGGTGGGGG + Intronic
1163083064 19:14957347-14957369 TGAATTTGGTTGGAGTGGGGAGG - Intronic
1163159167 19:15454607-15454629 GGACCATGCTGGGAGTGTGGGGG - Intronic
1163749995 19:19071044-19071066 AGGCTGGAGTGGGAGTGTGGTGG + Intronic
1164025677 19:21349908-21349930 TGACTTTGGAGGGAGTGTAGTGG - Intergenic
1164557966 19:29268256-29268278 GGACAGTGGTGGGAGGCTGGTGG + Intergenic
1165454942 19:35904942-35904964 TTACAGTGGCTGGAGTGTGGGGG - Intronic
1165712997 19:38025326-38025348 TGAGTGTGCTGGGATTGTGGAGG + Intronic
1165828538 19:38719254-38719276 AGACTGTGTTGGGAAGGTGGTGG - Intronic
1166140725 19:40803816-40803838 TGACTGGGGTGTGTGTGTAGTGG + Intronic
1166399572 19:42468372-42468394 AGGCTGTGGGGGGAATGTGGTGG + Intergenic
1166695981 19:44851597-44851619 TTCCTGTGGTGGCAGAGTGGAGG - Intronic
1167142992 19:47665038-47665060 TGACTGAGGTTGCAGAGTGGGGG - Intronic
1167575381 19:50315342-50315364 GGACTGTGGTGGGAATGGGGCGG - Intronic
1167594590 19:50420376-50420398 TGGCTGGGGTGTGAATGTGGAGG - Intronic
1168339500 19:55615103-55615125 TGTCTGTGGTGGGAGGGTCGGGG - Exonic
1168573354 19:57488356-57488378 AGACTGGGGTGGGGGTGAGGCGG + Intronic
1168574771 19:57500486-57500508 AGACTGGGGTGGGGGTGAGGCGG + Intronic
1168679516 19:58304324-58304346 TGACTGTGGTAGGAGTAGGGAGG + Intronic
1202638900 1_KI270706v1_random:64942-64964 GTACGGTGGTGGGAGGGTGGTGG - Intergenic
925291297 2:2750222-2750244 TGAGTGTGGTGTGTGTGGGGTGG + Intergenic
925691244 2:6525544-6525566 TGACTCTGGTTGGAGTCCGGGGG - Intergenic
925946617 2:8870022-8870044 GGTCTGTGGTGGGAGACTGGGGG - Intronic
925969029 2:9094156-9094178 TGACTGTGGTGGGCGTGAGGTGG - Intergenic
925976274 2:9144237-9144259 TGTGTGTGGTGTGTGTGTGGGGG - Intergenic
926299512 2:11592607-11592629 GGACGGTGGTGAGATTGTGGCGG + Intronic
927145820 2:20165213-20165235 TGAATGTGGTGTGTGTGTGGTGG - Intergenic
927179423 2:20434089-20434111 GGACTGTGATGGGAGGGAGGAGG + Intergenic
927245477 2:20954127-20954149 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
927395823 2:22650146-22650168 TGTCTGTGGTGCGGGTGTGTGGG - Intergenic
927424934 2:22971095-22971117 AGACTGTGGGGGGGGTGGGGGGG + Intergenic
927435638 2:23064018-23064040 TGACTGTGGTGGTGGTGGTGGGG - Intergenic
931208855 2:60173392-60173414 TCACTGAGGCTGGAGTGTGGTGG - Intergenic
931251579 2:60535844-60535866 TAACTGGGGTGGGATGGTGGTGG - Intronic
931674395 2:64679551-64679573 TTACTGTGGTGTGGGTGTTGGGG + Intronic
931779158 2:65564789-65564811 GGACAGTGGAGGGAGAGTGGGGG + Intergenic
932100607 2:68896328-68896350 TGTAGGTGGTGGGAGCGTGGGGG + Intergenic
932261734 2:70332754-70332776 TGGGTGGGGTGGGAGTGTGAAGG + Intergenic
932912806 2:75822229-75822251 TGCAAGTGGTGGGGGTGTGGGGG - Intergenic
934028129 2:88017585-88017607 GAACTGGGGAGGGAGTGTGGTGG - Intergenic
934781153 2:96970509-96970531 TGTTCGTGGTGGGAGTCTGGGGG + Intronic
935520360 2:104096753-104096775 TGGCAGGGGTGGGAGGGTGGAGG - Intergenic
936526065 2:113242283-113242305 TGACTCTGGGGGGACTGCGGTGG + Intronic
937390155 2:121478936-121478958 TGTGTGTGGTGTGTGTGTGGGGG - Intronic
937993184 2:127675234-127675256 TGAGGGTGGTGGGGGTGTTGGGG + Intronic
938097067 2:128471099-128471121 TCACTGTGGTGGGCGGGAGGAGG + Intergenic
938097282 2:128471941-128471963 TCACTGTGGTGGGCGGGAGGAGG + Intergenic
938735059 2:134178367-134178389 GGACTGTGGAGGCAGGGTGGTGG + Intronic
939459875 2:142486138-142486160 AGAGTGAGGTGGGAGTGAGGAGG + Intergenic
939529788 2:143343554-143343576 TCACTGTGTTGGCAGTGTGGGGG + Intronic
939674790 2:145059381-145059403 TGATTTTGGTGGGGGTGGGGAGG + Intergenic
939697477 2:145344294-145344316 AAACTGTGGTTGGAGTGTAGAGG - Intergenic
939810736 2:146828972-146828994 TGATTATGGTGGGTGTGTGGTGG - Intergenic
940210213 2:151249098-151249120 TGAAAGTGGTGGGGGTGTAGGGG + Exonic
940365431 2:152843603-152843625 TGAATGTGTTGGGTGTGCGGTGG + Intergenic
940635999 2:156297636-156297658 TGATTGTGATGGGAGTTTGATGG - Intergenic
942147315 2:173039578-173039600 TCCCTGTGGTTGGAGTGTGGAGG - Intronic
942596214 2:177593938-177593960 TGACTGGGGTGGGAGATTGTAGG + Intergenic
942628959 2:177935577-177935599 TGAGTGTGGAGGGAGTGGAGGGG - Intronic
942681979 2:178486318-178486340 TGTGTGTGGTTGGAGTGTGTGGG + Intronic
942801831 2:179884181-179884203 GGGCAGGGGTGGGAGTGTGGGGG + Intergenic
944026947 2:195181888-195181910 GGACTGTTGTGGGGGTGGGGTGG - Intergenic
944134404 2:196382974-196382996 TGGCTCTGGTGGCAGTATGGGGG + Intronic
944273056 2:197804844-197804866 GGACGGTGGCGGGAGTGGGGAGG - Exonic
944425361 2:199576494-199576516 GGACTGAGGTGGGTGTGTGTGGG + Intergenic
944656015 2:201877357-201877379 TGATTGGGGTGGGACTGTGGAGG + Intronic
945335950 2:208592610-208592632 TGCCTGAGGTTGGAGTGTAGAGG - Intronic
946066050 2:216988134-216988156 TGAAGATGATGGGAGTGTGGGGG - Intergenic
946254893 2:218435224-218435246 TGAATGTAGTAGGAGGGTGGAGG + Intronic
946288881 2:218728146-218728168 TGACTGGGGTGGGTGGGTGGGGG + Intronic
946418872 2:219553835-219553857 TGTCAGTGGTGGGGGTGGGGGGG + Intronic
947513318 2:230779296-230779318 CGTATGTGGTGGGAGTGTGGAGG - Intronic
947697211 2:232201670-232201692 TGACTGTGGTGTTAGTGTTGTGG + Intronic
947799454 2:232919357-232919379 TGAGTGCGGTGGGAGTGAGACGG + Intronic
948304742 2:236938274-236938296 TGTGTGTGGTGTGGGTGTGGTGG + Intergenic
948716554 2:239869268-239869290 TGTCTGTGGTGTGTGTGAGGAGG - Intergenic
948717966 2:239877868-239877890 AGGCTGTGGTGGGAAGGTGGGGG - Intergenic
1169376647 20:5071890-5071912 TGGGTGTGGTGGCAGCGTGGTGG - Intronic
1169410934 20:5369850-5369872 CGAGGGTGGTGGGAGGGTGGGGG - Intergenic
1169812411 20:9621677-9621699 TGACTTAGGTCTGAGTGTGGTGG + Intronic
1170089098 20:12570362-12570384 TGATTGTGGTGACAGAGTGGGGG - Intergenic
1170562221 20:17568276-17568298 TAACTCTGGTGGCAGAGTGGAGG + Intronic
1170690097 20:18606769-18606791 GGACTGTGGTGGGGGGGGGGAGG + Intronic
1170789292 20:19494567-19494589 TGTTTGGGGTGGGAGTTTGGGGG + Intronic
1170949589 20:20924725-20924747 TGCCTGTGGTGGGAGGAGGGGGG - Intergenic
1171015215 20:21534667-21534689 TGAGTGTGATGGGGGTGGGGAGG - Intergenic
1171154432 20:22859304-22859326 TGCCTGTGGAGGGAGTGGTGGGG + Intergenic
1171885501 20:30649069-30649091 GTACGGTGGTGGGAGGGTGGTGG - Intergenic
1172457124 20:35086057-35086079 TGGCAGTGGTGGTGGTGTGGGGG - Intronic
1172615941 20:36284442-36284464 CCATTGTGGTGGGAGTGTAGTGG + Intergenic
1172620401 20:36315001-36315023 TGTGTGTGGTGCGTGTGTGGTGG + Intronic
1172995764 20:39069445-39069467 TGAGGGTGGTGGGACTGAGGTGG + Intergenic
1173261904 20:41443917-41443939 TGTCTATGGTGGGTGTGTTGGGG + Intronic
1173726413 20:45301288-45301310 AGGGTGTGGTGGGAGGGTGGGGG + Intronic
1174109425 20:48187909-48187931 TGCCTATGGTGGGAGGGTAGTGG - Intergenic
1174136843 20:48385649-48385671 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
1174174442 20:48636091-48636113 GGCCTGAGGTGGGAGTGGGGTGG - Intronic
1175198489 20:57262731-57262753 TTATTATGGTGGGAGTTTGGCGG - Intronic
1175493800 20:59398471-59398493 TGCATGTGGAGGGGGTGTGGGGG - Intergenic
1175571649 20:60027241-60027263 GGACAGTGGTGGGAGGGTGATGG + Intronic
1175599571 20:60262156-60262178 GGACTAGGGTGGGAGTGTGGTGG + Intergenic
1175631632 20:60543872-60543894 GGAGTGGGGTGGGAGTGGGGTGG - Intergenic
1175777780 20:61663873-61663895 CGCCAGCGGTGGGAGTGTGGAGG - Intronic
1175996423 20:62814116-62814138 TGCCTGTGGGGGCAGAGTGGTGG + Intergenic
1176238376 20:64064636-64064658 TGACTGCAGTGGGGGTTTGGGGG + Intronic
1176245083 20:64093598-64093620 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245091 20:64093621-64093643 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245135 20:64093772-64093794 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245147 20:64093807-64093829 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245176 20:64093890-64093912 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245209 20:64093985-64094007 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245221 20:64094021-64094043 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245320 20:64094313-64094335 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245330 20:64094347-64094369 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245366 20:64094463-64094485 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245384 20:64094510-64094532 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1177386318 21:20413506-20413528 TGAGTTTGGAGGGACTGTGGAGG - Intergenic
1177808939 21:25903960-25903982 AGCCTGTGGTGGAAGTGTGAGGG + Intronic
1178258145 21:31074207-31074229 TGTTTGTGGTGGGGGAGTGGTGG - Intergenic
1178289446 21:31354465-31354487 TTCGTGTGGTGGGGGTGTGGAGG - Intronic
1178558517 21:33616078-33616100 GGACTGTGGTGGGGTTGGGGGGG - Intronic
1179093431 21:38289791-38289813 TGAGTGTGGAGGGGGTGAGGAGG - Intronic
1179389816 21:40977605-40977627 GGACTGTGATGCAAGTGTGGGGG - Intergenic
1179880999 21:44293302-44293324 GGGCTGTGGGGGGAGCGTGGGGG + Intronic
1180009894 21:45042701-45042723 TGTGTGTGGTGTGTGTGTGGTGG + Intergenic
1180199937 21:46218103-46218125 TGACTTTGGTGCGGGGGTGGGGG - Intronic
1180363059 22:11916947-11916969 GTACGGTGGTGGGAGGGTGGTGG + Intergenic
1180442019 22:15375545-15375567 AGACTGTCGTAGCAGTGTGGTGG + Intergenic
1180840355 22:18956205-18956227 TGCCAGAGGTGGGTGTGTGGAGG - Intergenic
1181061134 22:20282571-20282593 TGCCAGAGGTGGGAGTGTGGAGG + Intronic
1181086427 22:20441681-20441703 TGAATGGGGTGGGGCTGTGGGGG - Exonic
1181260255 22:21592264-21592286 GGACTGGGGTGGGAGTGGGGGGG - Intronic
1181401487 22:22652575-22652597 TGAGTGTGTGGGGGGTGTGGGGG + Intergenic
1181921928 22:26327329-26327351 TGTGTGTGGTGTGTGTGTGGGGG - Intronic
1182350420 22:29696111-29696133 TCACCCAGGTGGGAGTGTGGTGG + Exonic
1182407174 22:30144996-30145018 TAACTGAGCTGGGAGGGTGGAGG + Intronic
1182884417 22:33761142-33761164 TTGATGTAGTGGGAGTGTGGTGG - Intronic
1183019713 22:35017537-35017559 TGGATGTGGTGGGAGCCTGGGGG - Intergenic
1183062235 22:35343329-35343351 TGTGTGTGGTGTGTGTGTGGGGG - Intronic
1183211325 22:36453178-36453200 TCACTGAGGCTGGAGTGTGGTGG - Intergenic
1183330797 22:37220191-37220213 TGAGTGTGGGGTGATTGTGGAGG + Intergenic
1183368543 22:37419742-37419764 TGGCTGTGCTGGGGGTGTGTTGG - Intronic
1183493655 22:38129694-38129716 TGACTTGGGTGGGGGTGAGGAGG - Intronic
1183582045 22:38731925-38731947 TGCCTGGGGTGGGACTGTGCAGG + Exonic
1183613492 22:38927264-38927286 GGGCGGTGGTGGGAGTGTCGCGG + Intergenic
1183978999 22:41528756-41528778 TGACTGTGGTTGTGGTGGGGGGG + Exonic
1184239841 22:43206297-43206319 TGACTGTGGTGTGTGTGTAGGGG - Intronic
1184561220 22:45263953-45263975 GGACTGTAGGGGGAGTGCGGAGG - Intergenic
1184700587 22:46169560-46169582 AAACTGTGGTGGGAGTGAGGTGG + Intronic
1184858447 22:47159821-47159843 GGAGTGTGGTGCGTGTGTGGGGG - Intronic
1184880961 22:47303934-47303956 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
1185029918 22:48436793-48436815 TGATTGTGGGGAGAGTGTGCAGG + Intergenic
1185048602 22:48541609-48541631 TGTCGGTGTTGGGAGGGTGGAGG + Intronic
1185119371 22:48956866-48956888 TGTGTGTGGTGTGTGTGTGGGGG - Intergenic
1185399082 22:50606758-50606780 GGCCCGAGGTGGGAGTGTGGGGG + Exonic
1185403191 22:50629003-50629025 TGTCTGTTGTGTGCGTGTGGTGG + Intergenic
949090896 3:27803-27825 TGCCGGGGGTGGGAGGGTGGTGG - Intergenic
949151435 3:772709-772731 GGACTGTTGTGGGGGAGTGGGGG - Intergenic
952135518 3:30414474-30414496 TGACTGAGGTTGGACTGTAGTGG + Intergenic
952243686 3:31562249-31562271 TGTCTGTGCTGGTATTGTGGTGG + Intronic
953155924 3:40373227-40373249 TGATTGTGGTGGTGGGGTGGTGG + Intergenic
953191753 3:40694338-40694360 TAAAAGTGGTGGGAGTGGGGAGG - Intergenic
953193532 3:40711734-40711756 TGTATGTGGGGAGAGTGTGGGGG - Intergenic
953557663 3:43959734-43959756 TGTCTGTGGTGGGTGGGTGTGGG - Intergenic
955319415 3:57963724-57963746 AGGCTGGGGTGGGAGTGAGGTGG + Intergenic
955912907 3:63875882-63875904 TGTCTGTGGTGGTAATATGGTGG + Intronic
956649238 3:71488408-71488430 GAACTGGGGTGGGGGTGTGGAGG + Intronic
957268251 3:77995622-77995644 TAAATGTGGTTGGAGTGTTGAGG - Intergenic
957314792 3:78563453-78563475 TGAATGAAGTAGGAGTGTGGGGG - Intergenic
957507165 3:81136826-81136848 GGCCTGTGGTGGGGGTGAGGGGG - Intergenic
958513824 3:95086010-95086032 TGTGTGTGGTGGGGGAGTGGGGG + Intergenic
961612138 3:128148430-128148452 TCACTGTGATGGGAGTGGAGTGG + Intronic
963797991 3:149650215-149650237 TAACTGTGGTGGTGGAGTGGTGG - Intronic
963904342 3:150762065-150762087 TGACTGTGTGGGGATTGAGGAGG - Intronic
964201604 3:154123121-154123143 TAAATGTGTTGGGAGTGGGGAGG + Intronic
964705953 3:159618821-159618843 TGCTTGAGATGGGAGTGTGGGGG + Intronic
964949936 3:162277702-162277724 TGAATGGGGTGGGAGTCTGAAGG - Intergenic
966252961 3:177887452-177887474 TCTCTGTGGTGGCAGAGTGGAGG - Intergenic
966856481 3:184197308-184197330 TGGCTCTGGCTGGAGTGTGGTGG + Intronic
967334858 3:188332907-188332929 CAACTGGGGTGGGAGGGTGGGGG - Intronic
967512085 3:190323547-190323569 TGTGTGTGGTGCGAGTGTGGTGG + Intronic
967933276 3:194706018-194706040 GGGCAGTGGTGGGAGTGGGGAGG + Intergenic
968539428 4:1156214-1156236 AGACTGTGCTGGGAGTGGCGAGG + Intergenic
968548308 4:1209864-1209886 TGTCTGTGGTGTGAGCCTGGCGG - Intergenic
969155363 4:5205293-5205315 TGACAATGGTGGGACTATGGAGG + Intronic
969162527 4:5273833-5273855 GGACTGTGGTGGGTGGGGGGAGG + Intronic
969325415 4:6441290-6441312 TCACTGTGGTGTCGGTGTGGAGG - Intronic
969359290 4:6651756-6651778 TGAGTCTGGTGGGTGTGGGGAGG + Intergenic
969408343 4:7010469-7010491 TGGCTGGGGTGGCAGAGTGGTGG + Intronic
969564627 4:7970677-7970699 TGACTGTGGGGGGGCGGTGGAGG + Intronic
969687935 4:8686886-8686908 TGTGTGTGGTGTGTGTGTGGAGG + Intergenic
969973844 4:11077386-11077408 GGACTGTTGTGGGGTTGTGGGGG - Intergenic
970979250 4:22077561-22077583 TGTATCTGGTGGGTGTGTGGTGG - Intergenic
972979610 4:44679362-44679384 TGACTCTGGTGGGAGAGGGTGGG + Intronic
973977298 4:56275128-56275150 TGAGTGTGGAGGGTGAGTGGGGG + Intronic
974585824 4:63875673-63875695 TGGTGCTGGTGGGAGTGTGGCGG - Intergenic
975190204 4:71451690-71451712 TGGGTGTGGTGGGTGTGTGGGGG + Intronic
976172874 4:82322789-82322811 TCACTCTGGTGCCAGTGTGGAGG - Intergenic
976663734 4:87567807-87567829 TGATTGGGGTGTGTGTGTGGGGG - Intergenic
976899840 4:90159071-90159093 TCACTGAGGTTGGAGTGTAGTGG + Intronic
978499980 4:109399233-109399255 TGACTTTGGTGGGAGGTGGGAGG - Intergenic
978940827 4:114434530-114434552 TGGCTGTGGTGGGATGCTGGTGG + Intergenic
979053433 4:115966192-115966214 TGATTGTGGTGGTAGTGCAGAGG + Intergenic
979363636 4:119794455-119794477 TAACTCTGGTGGCAGTGTGTAGG + Intergenic
980604451 4:135071210-135071232 GGACTGTTGTGGGAGGGGGGAGG + Intergenic
980670618 4:136000939-136000961 TGACTGTGGTGGGCCAGTGTTGG - Intergenic
980739836 4:136935820-136935842 TGCGTGTGGAGGGGGTGTGGGGG - Intergenic
980818700 4:137983357-137983379 TGAATGTGGGCCGAGTGTGGTGG + Intergenic
981431566 4:144667307-144667329 TCACTGAGGCTGGAGTGTGGTGG - Intronic
981511901 4:145566639-145566661 TGACAGCAGTGGCAGTGTGGTGG - Intergenic
981751435 4:148095785-148095807 TGGCTGGGATGGGAGGGTGGAGG + Intronic
983518290 4:168679332-168679354 TGTGTGTGGTGGGTGTGTGGTGG + Intronic
984520018 4:180790210-180790232 TTACTGTGGTTGGAGTGAAGAGG - Intergenic
1202766250 4_GL000008v2_random:150801-150823 GTACGGTGGTGGGAGGGTGGTGG - Intergenic
985656452 5:1134025-1134047 TGTCTGGGGTGGGTCTGTGGTGG - Intergenic
985821958 5:2166546-2166568 TGACTGTGGTGGGAGTGTGGGGG + Intergenic
985927568 5:3029723-3029745 CGGCTGGTGTGGGAGTGTGGAGG + Intergenic
986699577 5:10392815-10392837 AAACTGTGGTGGGAGGGAGGAGG - Intronic
986793041 5:11181926-11181948 TGTGTGTGGTGTGTGTGTGGGGG + Intronic
986799035 5:11240793-11240815 TGTGTGTGTTGGGTGTGTGGGGG - Intronic
986866903 5:11999952-11999974 TGTGTGTGGTGGGGGTGGGGGGG - Intergenic
987471231 5:18331130-18331152 GGTCTGTGGAGGGGGTGTGGAGG - Intergenic
988081982 5:26426456-26426478 GGACTGTTGTGGGGGTGGGGGGG + Intergenic
988527970 5:32002905-32002927 TGTGTGTGGTGTGTGTGTGGTGG - Intronic
989478998 5:41906387-41906409 TTACTGTGGCAGGGGTGTGGTGG - Intronic
990000700 5:50888331-50888353 TGTATGTGTTGGGAGTGTGAGGG - Intergenic
991365649 5:65865341-65865363 AGGCTGAGGTGGGAGTGAGGTGG - Intronic
991914122 5:71588993-71589015 TCAGTGTGGTGGCAATGTGGAGG + Intronic
992071064 5:73149799-73149821 TGACTGTGGTGGTAGTGATAAGG + Intergenic
992268039 5:75037297-75037319 GGAGTGCTGTGGGAGTGTGGAGG - Intergenic
992407802 5:76476156-76476178 TGTGTGTGGTTGGAGTGTAGTGG + Intronic
992843064 5:80715490-80715512 TGACAGTGGTGGGTGGGGGGTGG + Intronic
992978658 5:82142649-82142671 ATACTGTGGCGGCAGTGTGGAGG + Intronic
993981143 5:94545051-94545073 TGACTGGGGTGGGGGTTGGGGGG + Intronic
995290777 5:110450129-110450151 TGATTATGGTGGAAGTGTGAAGG - Intronic
995967719 5:117929485-117929507 TGCCTGAAGTGGGAGTGGGGAGG - Intergenic
996024843 5:118633026-118633048 AGAATGTAGTGGGAGGGTGGAGG + Intergenic
997834373 5:137180356-137180378 TGACTGGGGTGGGGGTGGGTAGG + Intronic
997978711 5:138455577-138455599 GGTCTGGGGTTGGAGTGTGGTGG + Intergenic
998187508 5:139993106-139993128 TGTGTGTGGTGTGTGTGTGGTGG + Intronic
998298703 5:140997129-140997151 TCACTGTGGCGGGGGTGTGGGGG - Intronic
998329272 5:141309541-141309563 TGTCTGAGGTGGGAGTGGGGTGG - Intergenic
998344526 5:141450157-141450179 TGGGTGTGGTGGGAGTGTGGTGG - Intronic
999079125 5:148826704-148826726 CGGCTGTGGTGTGGGTGTGGTGG - Exonic
999178974 5:149655395-149655417 TGTGTGTGGTGTGTGTGTGGGGG - Intergenic
999304755 5:150512232-150512254 TGAATGTGGTGTGTGTGTTGGGG + Intronic
999970025 5:156850247-156850269 TGGGTGTGGTGGGGGTGGGGGGG - Intergenic
1000243932 5:159433424-159433446 TAACTGGGGTCGGAGTGGGGTGG + Intergenic
1000329992 5:160198632-160198654 ACAGTGTGGTGGGAGTTTGGTGG - Intronic
1000463596 5:161549100-161549122 TGACTCCGGGGGAAGTGTGGAGG + Intronic
1001364316 5:171121820-171121842 TGGCAGGGGTGGGGGTGTGGTGG - Intronic
1001569530 5:172721059-172721081 TGGCTGTGGTCGGGGGGTGGTGG + Intergenic
1001903783 5:175453879-175453901 AGACTCAGGTGGGAGTGTGTGGG + Intergenic
1001913292 5:175538916-175538938 TGAGTGTTCTGGTAGTGTGGAGG - Intergenic
1001972687 5:175969005-175969027 TGGCACTGGTGGGAGTGTAGAGG - Intronic
1002156211 5:177282267-177282289 TGACAGTGGTAGGAGTAAGGAGG + Intronic
1002244751 5:177874777-177874799 TGGCACTGGTGGGAGTGTAGAGG + Intergenic
1002346001 5:178547775-178547797 TGTGTGTGGGGGGTGTGTGGGGG - Intronic
1002671636 5:180872382-180872404 TGTGTGTGGTGGGAGTGGGAGGG + Intergenic
1002947726 6:1779016-1779038 TGGCTGGGGTGGGAGTGAGGAGG + Intronic
1002976810 6:2087084-2087106 TGCCTGTGGTGGGAGTGGAAAGG - Intronic
1003106660 6:3221991-3222013 TGGTGGTGGTGGTAGTGTGGTGG - Intergenic
1003151942 6:3559920-3559942 TGATTTTGGTGGCAGTGTAGGGG + Intergenic
1003601215 6:7519179-7519201 TGACTGTAGTCTGAGGGTGGGGG - Intergenic
1003974727 6:11331458-11331480 TGGCGGTGGTGGGAGTGGGGAGG + Intronic
1004885552 6:20048347-20048369 TTACTGGGGTGGAAGTGAGGGGG + Intergenic
1005546111 6:26873612-26873634 TGACTGTGGTGACAGTATCGGGG + Intergenic
1006052322 6:31354605-31354627 TGGTGGGGGTGGGAGTGTGGAGG - Intronic
1006101826 6:31690298-31690320 TGATTGTGTGGGGTGTGTGGTGG + Intronic
1006441806 6:34057953-34057975 TGTGTGTGGTGGGTGGGTGGAGG + Intronic
1006770964 6:36552418-36552440 TGAATCTGGTGGGAGTGGGTGGG - Intergenic
1006903788 6:37519652-37519674 TGACTGGAGTAGGTGTGTGGCGG + Intergenic
1007090033 6:39178360-39178382 TCCCTGTGGTGGGAGAGCGGTGG - Intergenic
1007273717 6:40658178-40658200 AGGCTGTGGTGGGAGTGTGTGGG + Intergenic
1007455769 6:41975879-41975901 TCACTGAGGCTGGAGTGTGGTGG + Intronic
1007781018 6:44254814-44254836 TCACTGTGGTGGGAGGGCTGGGG - Exonic
1008352248 6:50505719-50505741 TGACTGAGAAGGGAGGGTGGTGG + Intergenic
1009298892 6:61989911-61989933 TGACTGGGGTGGGGTTGGGGAGG + Intronic
1009333415 6:62454993-62455015 TGCATGTTGTGGGGGTGTGGGGG + Intergenic
1010521086 6:76838430-76838452 TGACTCCTGTGGGAGTGAGGAGG + Intergenic
1010625202 6:78130652-78130674 TGGCTGGGGTGGGAGAGGGGTGG - Intergenic
1011423789 6:87203717-87203739 TGACTGGGGTGGCTGTGTGTGGG + Intronic
1012448941 6:99334702-99334724 TCCCTCTGGTGGCAGTGTGGAGG - Intronic
1013017995 6:106178613-106178635 TGACTCTGGTGGCAGTGTGCAGG - Intergenic
1013854809 6:114559653-114559675 TGACTTTGGTTATAGTGTGGAGG - Intergenic
1013878211 6:114860609-114860631 TGTGTGTGGTGGGGGTGTGGAGG + Intergenic
1014322379 6:119946079-119946101 TGAGTGTGTTGGGAGGATGGGGG - Intergenic
1015429232 6:133110831-133110853 TGACTGTATTGGGTGGGTGGAGG + Intergenic
1015633299 6:135252405-135252427 TCACTTTGGTGGCAGGGTGGTGG - Intergenic
1015717271 6:136205588-136205610 TGACTGTGGTGGTCTTGGGGAGG + Intergenic
1016922281 6:149307435-149307457 TGGCAGGGGTGGGGGTGTGGTGG - Intronic
1017714763 6:157201186-157201208 CGGCTGTGGTGGGCGTGTGATGG - Exonic
1018699715 6:166416717-166416739 TGATTGTGGAGGGATGGTGGAGG - Intronic
1019339937 7:504228-504250 TGCCTGTGGTGGGTGGGTGGTGG - Intronic
1019376227 7:693886-693908 TGGATGTTGTGGGGGTGTGGGGG - Intronic
1019512329 7:1423951-1423973 AGACTGAGCTGGGAGTGAGGGGG + Intergenic
1019852435 7:3573205-3573227 AGACTGTGCTGGGAGGGTGGAGG + Intronic
1020012528 7:4814554-4814576 TGACTGTGTTGGGAGGGGGGTGG + Intronic
1020394136 7:7694522-7694544 GGACAGTGGTGGGGGTGGGGTGG - Intronic
1020428449 7:8095296-8095318 TGAATTTGGTGGGGGTGGGGTGG + Intergenic
1021146696 7:17097923-17097945 TGAAGGTGGTGGGCTTGTGGTGG - Intergenic
1021576169 7:22108229-22108251 GGGCTGAGGTGGGAGTGGGGAGG - Intergenic
1021588836 7:22239169-22239191 GGCCTGTGCTGGGAGAGTGGAGG + Intronic
1021602585 7:22378979-22379001 TTCCTGTGGTAGGAGTGAGGAGG - Intergenic
1022048170 7:26639679-26639701 TGTTTGTGGTGGGTGTGTGTGGG - Intronic
1022525747 7:31035909-31035931 TGCCTGTGGTGGGTGGGTGTGGG - Intergenic
1022732554 7:33043760-33043782 TGTATGTGGTAGGAGTGGGGTGG + Intronic
1022761578 7:33360558-33360580 TCACTGAGGTTGGAGTGCGGTGG + Intronic
1022816530 7:33919513-33919535 TGAGGGTGGTGGGACAGTGGTGG + Intronic
1023079700 7:36515353-36515375 TGTGTGTGGTGTGTGTGTGGGGG - Intronic
1023216967 7:37872870-37872892 TGTGTGGGGTGGGGGTGTGGTGG - Intronic
1023848130 7:44134721-44134743 TTGTGGTGGTGGGAGTGTGGAGG + Intergenic
1024207958 7:47179881-47179903 GGACTGGGGTGGGGGTGTGGAGG - Intergenic
1024233067 7:47377502-47377524 TGATAGTGGTGGGAGTGTCATGG + Intronic
1024393887 7:48844547-48844569 TGCCTGTGCTGGGAGCATGGAGG - Intergenic
1024401358 7:48927868-48927890 TGCCTGTGCTGGGAGCATGGAGG + Intergenic
1025519058 7:61696772-61696794 GGACTGTGGTGGGGGGGAGGGGG + Intergenic
1025543382 7:62125418-62125440 GGACTGTGGTGGGGGGGAGGGGG + Intergenic
1026461853 7:70621300-70621322 TCACTGTGGGGGCAGGGTGGGGG + Intronic
1026471955 7:70701236-70701258 TGATTGTGGTGGGGGTTGGGGGG + Intronic
1026487333 7:70832707-70832729 TGCCAGTAGTGGGAGTGAGGTGG + Intergenic
1026929337 7:74215271-74215293 TGCCTGTGGTGGGAGCTGGGAGG - Intronic
1027655895 7:80930437-80930459 GGAGTGTGGGGGGAGGGTGGTGG - Intergenic
1027988662 7:85329866-85329888 GGACTGTGGTGGGTGGGGGGAGG - Intergenic
1028604621 7:92642312-92642334 TGACTGTGGTGGGATATAGGGGG + Intronic
1029809838 7:103036177-103036199 GGACTGTGGTGGGGTGGTGGGGG - Intronic
1029933438 7:104397803-104397825 TGGCTTTGGAGGAAGTGTGGGGG + Intronic
1030232083 7:107219188-107219210 AGATTGTGGTGAGAGTGTGGGGG + Intronic
1031650910 7:124288826-124288848 TGACTCTGGCAGTAGTGTGGAGG - Intergenic
1031928415 7:127660386-127660408 AGACTGTGGTGGGAGTGTGGGGG + Intronic
1031991866 7:128203613-128203635 TCACTGAAGTGGGAGTGGGGAGG - Intergenic
1032256589 7:130302140-130302162 TGACTGAGCTAGGAGGGTGGTGG - Intronic
1032398905 7:131610201-131610223 TGACTGTCGTGGTCATGTGGTGG + Intergenic
1032403674 7:131640802-131640824 TGAGTGCGGTAGGAGTCTGGAGG + Intergenic
1033794249 7:144828928-144828950 TGAATTTGGTGGGAGTGGGGGGG - Intronic
1034341493 7:150359522-150359544 TGTGTGTGGTGTGTGTGTGGTGG - Intergenic
1034428087 7:151025129-151025151 TCACTGTAGTGTGTGTGTGGAGG - Intergenic
1034918370 7:155059418-155059440 TGGCTCTGGTGGAACTGTGGTGG - Intergenic
1035283188 7:157790117-157790139 TGTGTGTGGTGTGTGTGTGGTGG + Intronic
1035339563 7:158151560-158151582 TGCCTGTGGTGGGGTGGTGGTGG + Intronic
1035407542 7:158609474-158609496 TTTCTGAGGAGGGAGTGTGGGGG + Intergenic
1035792080 8:2316345-2316367 AGAATGAGGTTGGAGTGTGGGGG + Intergenic
1035800725 8:2405360-2405382 AGAATGAGGTTGGAGTGTGGGGG - Intergenic
1035820042 8:2580869-2580891 CGCTTGTGGTGGGAGTGTGCAGG + Intergenic
1036057136 8:5268328-5268350 TGACTGTGGAGGGTGTTTGTTGG - Intergenic
1036479863 8:9130151-9130173 GGACCATGGTGGGAGTGGGGTGG + Intergenic
1036766644 8:11553706-11553728 AGGCTGGGGTGGGGGTGTGGAGG + Intronic
1037508950 8:19562129-19562151 TGGCTGTGGGGGGTCTGTGGGGG - Intronic
1037572272 8:20168325-20168347 TGACTGAGGCTGGAGTGTAGAGG - Intronic
1037764963 8:21767045-21767067 TGCCTGTGATGCGTGTGTGGTGG - Intronic
1038403843 8:27307332-27307354 TGTGTGTGGCGGGGGTGTGGCGG - Intronic
1038666789 8:29544342-29544364 TGACTGGAGTGGGAGGTTGGGGG - Intergenic
1038748566 8:30275432-30275454 TGACTGGGGGTGGAGGGTGGGGG - Intergenic
1039399938 8:37260958-37260980 CGAGGGAGGTGGGAGTGTGGGGG + Intergenic
1039913728 8:41844507-41844529 TGTGTGTGGGGGGTGTGTGGTGG - Intronic
1040102281 8:43516388-43516410 GTAGGGTGGTGGGAGTGTGGAGG + Intergenic
1040887029 8:52276020-52276042 TGCATGTGGTGTGTGTGTGGGGG - Intronic
1041322183 8:56624826-56624848 TGGGTGGGGTGGGAGTGTGGAGG - Intergenic
1041477815 8:58285278-58285300 TGAATGTGGTGGGGTGGTGGGGG - Intergenic
1041660641 8:60397838-60397860 TGCCTGTGGTGGAAGAATGGGGG + Intergenic
1042387145 8:68189726-68189748 TAACACTGATGGGAGTGTGGGGG - Intronic
1042867842 8:73371104-73371126 TGACTGTGTTAGCAGTGTAGGGG - Intergenic
1043564742 8:81535352-81535374 TGAAGAAGGTGGGAGTGTGGGGG + Intergenic
1043636785 8:82394334-82394356 TGACGGTGGAGGGTGGGTGGAGG - Intergenic
1044496073 8:92884831-92884853 TAAATGTGATGGGAGTGGGGGGG + Exonic
1044578281 8:93795084-93795106 TAACTCTGGTGGTAGTGTGGAGG + Intronic
1045312936 8:101018970-101018992 TGACTGTGGTGAAAGTGGTGAGG + Intergenic
1046573905 8:116001137-116001159 AGACACTGGTGGGAGTGAGGAGG - Intergenic
1046880047 8:119298022-119298044 GGACTGTTGTGGGTGTGGGGAGG + Intergenic
1046957029 8:120072331-120072353 CCACTGTGGTGAGTGTGTGGTGG + Intronic
1046967525 8:120184194-120184216 TGTTTGTGGTGTGTGTGTGGGGG + Intronic
1047502681 8:125454268-125454290 TGACTCTGGTAGGAGGGTTGGGG + Intergenic
1047751416 8:127883470-127883492 TGACAGTGGGGGGAATGGGGAGG + Intergenic
1047753260 8:127898705-127898727 TCCCTGTGGTGGGGGTGAGGCGG + Intergenic
1048293019 8:133194677-133194699 TGTGTGTGGTGTGTGTGTGGAGG + Intronic
1048335940 8:133502285-133502307 TGAATTTGGTGGGGGTGTGGGGG - Intronic
1048871783 8:138804893-138804915 TGTGTGTGGTGGGTGTGTGATGG + Intronic
1049050887 8:140194260-140194282 TGACTGTGGGTGGGGTGTGAAGG - Intronic
1049423364 8:142526510-142526532 AGAGAGTGGTGGGGGTGTGGGGG - Intronic
1049434527 8:142580210-142580232 TGGCAGTGGTGGGAGTGGGCTGG - Intergenic
1049445146 8:142626694-142626716 TGAAGGTGGTGGTAGTGAGGGGG - Intergenic
1049734776 8:144199189-144199211 TCACTGTGCTGGGTGAGTGGTGG + Exonic
1050467751 9:5948467-5948489 TGTATGTGGTGGGAGTGGGGAGG + Intronic
1050541976 9:6678440-6678462 TGACTATAATGGGAGTGGGGAGG + Intergenic
1050974278 9:11916740-11916762 AGACAGTGGTGGTGGTGTGGGGG + Intergenic
1050999355 9:12261082-12261104 TAAGTGTTGTGGGAGAGTGGAGG - Intergenic
1051350685 9:16195619-16195641 TGTCTGTGCTGGGAGGGTGGTGG - Intergenic
1052662327 9:31449809-31449831 TGCCTGTGGTGTGTGTGTGTGGG - Intergenic
1052802195 9:32979183-32979205 TGACAGTGGCGGGAGGGAGGTGG - Intronic
1053600388 9:39603726-39603748 GAACTGGGGAGGGAGTGTGGTGG + Intergenic
1053858038 9:42357582-42357604 GAACTGGGGAGGGAGTGTGGTGG + Intergenic
1054253140 9:62738658-62738680 GAACTGGGGAGGGAGTGTGGTGG - Intergenic
1054274166 9:63052450-63052472 TGGCTGTGGGGGGGGGGTGGCGG - Intergenic
1054434282 9:65196835-65196857 TGGCTGTGGGGGGGGGGTGGCGG + Intergenic
1054496108 9:65824846-65824868 TGGCTGTGGGGGGGGGGTGGCGG - Intergenic
1054567256 9:66773157-66773179 GAACTGGGGAGGGAGTGTGGTGG - Intergenic
1056222843 9:84467280-84467302 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
1056558981 9:87713406-87713428 TGTGTGTGGTGTGTGTGTGGGGG + Intergenic
1056577879 9:87869790-87869812 TGTGTGTGGTGTGTGTGTGGTGG - Intergenic
1056750778 9:89349658-89349680 TGAATGTGGTGGTTGTGTGCAGG + Intronic
1056822973 9:89856575-89856597 TGACTGTGCTGGGAAGGAGGTGG - Intergenic
1057211688 9:93204046-93204068 TGTGTGTGGTGGGGGTGTGGGGG + Intronic
1057902001 9:98956669-98956691 TTACTGTGGCTGCAGTGTGGAGG - Intronic
1058363358 9:104177082-104177104 TGACTGTGGCAGCAGTGTGCTGG - Intergenic
1058871109 9:109202427-109202449 TGTGTGTGGTGGGTGTTTGGTGG - Intronic
1058918718 9:109592917-109592939 TGGCTGAGGTGGGAGTGAGGAGG + Intergenic
1059493629 9:114691089-114691111 TGAGTGTGGTGGGGCTGGGGAGG + Intergenic
1059542349 9:115143672-115143694 TCACTTTGGTGGGAGTATGGAGG - Intronic
1060151304 9:121290005-121290027 GGACAGTGGCTGGAGTGTGGGGG + Intronic
1060152669 9:121298869-121298891 TGACTCTAGTGGGAGGGTGGAGG + Intronic
1060180351 9:121529524-121529546 TGACCTTGGTGGGAGTGTTGGGG - Intergenic
1060280009 9:122209457-122209479 TGACTGCTGTGGGGGTGCGGTGG + Intronic
1060591968 9:124822907-124822929 TCACCCAGGTGGGAGTGTGGTGG - Intergenic
1060749898 9:126162336-126162358 TGACTGAGGTGGGAGAGATGTGG + Intergenic
1061662967 9:132142584-132142606 TGTGTGTGGTGTGTGTGTGGGGG - Intergenic
1061937116 9:133863981-133864003 TGTCTGTCCTGGGAGTGGGGTGG - Intronic
1062265597 9:135685326-135685348 GGATTGGGGTGGGAGTGCGGGGG - Intergenic
1062506011 9:136876911-136876933 TGCCTGCTGTGGGAGTGAGGAGG + Intronic
1203546999 Un_KI270743v1:135690-135712 GTACGGTGGTGGGAGGGTGGTGG - Intergenic
1186947228 X:14582216-14582238 GGACTGTTGTGGGGGTGGGGAGG - Intronic
1187562746 X:20418220-20418242 TCTCTGTGTTGGGAGTGGGGTGG + Intergenic
1188393535 X:29651617-29651639 TGGCTGGGATGGGAGTGTTGGGG + Intronic
1188424829 X:30034697-30034719 GGATGGTAGTGGGAGTGTGGGGG - Intergenic
1189316724 X:40062064-40062086 GGACTGTGGTGGGCGAGGGGAGG - Intronic
1189801261 X:44694007-44694029 TGACTGTGGTGGGGGTGCAGTGG - Intergenic
1190157336 X:48004610-48004632 TCAGTGTGTTGGGAGTGTAGGGG + Intronic
1190173106 X:48127495-48127517 TCAGTGTGTTGGGAGTGTAGGGG + Intergenic
1190581183 X:51894180-51894202 TGACTGTGGTCTGACTGTGCGGG - Intronic
1191720049 X:64221832-64221854 TGACTGTGCTGGGGGTAAGGGGG + Intergenic
1193171024 X:78335903-78335925 TGACTGTGGAGGGTGGGAGGAGG - Intergenic
1193570441 X:83134962-83134984 TGAGTGTGGAGGGAGGGAGGAGG + Intergenic
1193727324 X:85058223-85058245 GGCCTGTTGTGGGAGGGTGGGGG - Intronic
1194938760 X:99984099-99984121 AACCAGTGGTGGGAGTGTGGTGG - Intergenic
1195272225 X:103243100-103243122 TGTGTATGGTGGGAGTGTGGTGG - Intergenic
1195654198 X:107319644-107319666 TGTCTGTAGTGTGTGTGTGGGGG + Intergenic
1196141277 X:112265920-112265942 TGACTGTGAGGGGCCTGTGGGGG - Intergenic
1196609432 X:117695013-117695035 TGCCTGGGGTGGGAAAGTGGTGG - Intergenic
1196936694 X:120737377-120737399 AAACTGTGGTGGAACTGTGGTGG + Intergenic
1197316123 X:124967849-124967871 TGACCCTAGTGGCAGTGTGGAGG - Intergenic
1197542006 X:127775722-127775744 TCACCCAGGTGGGAGTGTGGTGG - Intergenic
1199208317 X:145175212-145175234 TGACTGAGGTGGAAGGGTGTAGG + Intergenic
1199286290 X:146058128-146058150 TTACTGTGGTGGCAGTGGGAAGG + Intergenic
1199820368 X:151439660-151439682 TGACTTTGGTAAGAGTGTTGGGG - Intergenic
1200066999 X:153508683-153508705 TGGCTGTGGTGGGAGAGCAGGGG - Exonic
1202106773 Y:21379050-21379072 TGTCTTTAGTGGAAGTGTGGGGG + Intergenic
1202132827 Y:21630014-21630036 TGGCCCAGGTGGGAGTGTGGTGG + Intergenic