ID: 1152295435

View in Genome Browser
Species Human (GRCh38)
Location 17:79464473-79464495
Sequence GGCCGCCCCGACAGATGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152295435_1152295442 20 Left 1152295435 17:79464473-79464495 CCAGTACATCTGTCGGGGCGGCC 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1152295442 17:79464516-79464538 CCCCGCAGACATCTGCCTGCTGG 0: 1
1: 0
2: 2
3: 9
4: 157
1152295435_1152295445 23 Left 1152295435 17:79464473-79464495 CCAGTACATCTGTCGGGGCGGCC 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1152295445 17:79464519-79464541 CGCAGACATCTGCCTGCTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152295435 Original CRISPR GGCCGCCCCGACAGATGTAC TGG (reversed) Intronic
904062767 1:27724626-27724648 TCCCGCCCCGACTCATGTACTGG + Intergenic
905175760 1:36134435-36134457 GGCCTCCCCTACATTTGTACTGG - Intergenic
905847008 1:41241914-41241936 GGCCGGCCAGACAGACGGACAGG + Intronic
907337482 1:53709932-53709954 GGGAGTCCCCACAGATGTACAGG + Intronic
1075800773 10:125152109-125152131 GGCCGCGCCGCCAGGTGTTCTGG + Intronic
1078740067 11:14058403-14058425 GGCCTCCCCGAGAGAAGCACAGG + Intronic
1084164817 11:67370661-67370683 GGCCACCCAGACAGCTGCACAGG + Intronic
1105013428 12:132771349-132771371 GGCCTCCTCTGCAGATGTACTGG - Exonic
1111833634 13:93360360-93360382 GGCCTCCCTGAGAGATGTCCAGG + Intronic
1122938242 14:104969842-104969864 GGCCGGCCCCACAGACGTCCAGG + Intronic
1129016753 15:72475023-72475045 GGCCGCCGCGCCAGCTGGACCGG + Intronic
1146606802 17:34266790-34266812 GGCAGCCCAGAGAGATGTCCTGG - Intergenic
1150640802 17:66948264-66948286 GGCCGGCCCAACAGCTGAACTGG - Intergenic
1152295435 17:79464473-79464495 GGCCGCCCCGACAGATGTACTGG - Intronic
1171305880 20:24105360-24105382 GGCCCCCCAGACTGATGCACAGG + Intergenic
1174185644 20:48704033-48704055 GGCCGCCCCTACGCATGTATTGG - Intronic
1174924234 20:54739914-54739936 GTCCACACAGACAGATGTACTGG - Intergenic
1175828100 20:61947792-61947814 GGCCGCCCCGACTGATGATGAGG + Intergenic
1179219126 21:39390684-39390706 GTCCGCCCTGCCAGATGTCCAGG + Exonic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
991667195 5:69011234-69011256 GGCCACCCCGACAGGTGCACAGG - Intergenic
999440541 5:151597348-151597370 GGCAGCTCTGACAGCTGTACTGG + Intergenic
1001751867 5:174137453-174137475 GGCCGCCCTCTCAGATGTGCGGG + Intronic
1019160035 6:170063437-170063459 CACTCCCCCGACAGATGTACTGG + Intergenic
1048926501 8:139276887-139276909 GGCTGCCCTGACCCATGTACAGG + Intergenic
1061756068 9:132813317-132813339 GGCCTCCCCGGGAGATGTCCTGG - Intronic