ID: 1152297953

View in Genome Browser
Species Human (GRCh38)
Location 17:79479270-79479292
Sequence AGGGAGAACCCAGGAGCTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 371}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152297941_1152297953 28 Left 1152297941 17:79479219-79479241 CCCAAGGGGTGGTTTTGGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1152297953 17:79479270-79479292 AGGGAGAACCCAGGAGCTCGCGG 0: 1
1: 0
2: 1
3: 29
4: 371
1152297945_1152297953 5 Left 1152297945 17:79479242-79479264 CCTTCTCTGAAGCCCATGTCCAG 0: 1
1: 1
2: 8
3: 27
4: 254
Right 1152297953 17:79479270-79479292 AGGGAGAACCCAGGAGCTCGCGG 0: 1
1: 0
2: 1
3: 29
4: 371
1152297942_1152297953 27 Left 1152297942 17:79479220-79479242 CCAAGGGGTGGTTTTGGCGGCCC 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1152297953 17:79479270-79479292 AGGGAGAACCCAGGAGCTCGCGG 0: 1
1: 0
2: 1
3: 29
4: 371
1152297943_1152297953 7 Left 1152297943 17:79479240-79479262 CCCCTTCTCTGAAGCCCATGTCC 0: 1
1: 0
2: 0
3: 33
4: 310
Right 1152297953 17:79479270-79479292 AGGGAGAACCCAGGAGCTCGCGG 0: 1
1: 0
2: 1
3: 29
4: 371
1152297944_1152297953 6 Left 1152297944 17:79479241-79479263 CCCTTCTCTGAAGCCCATGTCCA 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1152297953 17:79479270-79479292 AGGGAGAACCCAGGAGCTCGCGG 0: 1
1: 0
2: 1
3: 29
4: 371
1152297949_1152297953 -7 Left 1152297949 17:79479254-79479276 CCCATGTCCAGGCTGCAGGGAGA 0: 1
1: 0
2: 4
3: 49
4: 422
Right 1152297953 17:79479270-79479292 AGGGAGAACCCAGGAGCTCGCGG 0: 1
1: 0
2: 1
3: 29
4: 371
1152297950_1152297953 -8 Left 1152297950 17:79479255-79479277 CCATGTCCAGGCTGCAGGGAGAA 0: 1
1: 2
2: 4
3: 52
4: 454
Right 1152297953 17:79479270-79479292 AGGGAGAACCCAGGAGCTCGCGG 0: 1
1: 0
2: 1
3: 29
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152297953 Original CRISPR AGGGAGAACCCAGGAGCTCG CGG Intronic
900904191 1:5539398-5539420 AGGGAGAAAGCAGGAGTTTGGGG + Intergenic
901079404 1:6575332-6575354 AGGCACAGCCCAGGAGCTGGTGG - Exonic
901324570 1:8358947-8358969 GCGGAGACCCCAGGCGCTCGGGG - Intronic
902754011 1:18537346-18537368 AGGCAGAGCCCAGGAGGTGGAGG - Intergenic
903145173 1:21367194-21367216 AGCTTGAACCCAGGAGGTCGAGG + Intergenic
904128815 1:28260498-28260520 AGGGAGAGCGCAGGGGCTCTGGG + Intronic
904911460 1:33937401-33937423 AGAGATAACCCAGGAGCTGAGGG + Intronic
904923564 1:34028230-34028252 AGGCTGAACCCAGGAGGTCGAGG + Intronic
905014123 1:34765422-34765444 GGAAAGAACCCAGGAGCTCTTGG + Intronic
905043967 1:34982152-34982174 TGGAAGAACCCAGGAGATCCAGG + Intronic
907968332 1:59355774-59355796 AGTTAGATCCCAGGAGCTGGAGG - Intronic
908832427 1:68192659-68192681 AGCTTGAACCCAGGAGTTCGAGG + Intronic
914320143 1:146551314-146551336 TGGTTGAGCCCAGGAGCTCGAGG + Intergenic
914435850 1:147658713-147658735 GGGGAGAAGCCAGGAGCCAGAGG + Intronic
914855647 1:151348389-151348411 TGGGGGAACCCAGGAGATTGTGG + Intergenic
915126241 1:153667036-153667058 AGCTAGAACCCAGGAGGTGGAGG + Intronic
915585134 1:156840339-156840361 GGGGAGAACCCAGGGGCCTGGGG - Exonic
916069607 1:161162156-161162178 GGGGAAAACCCACGAGCTTGGGG + Intronic
916409468 1:164531339-164531361 AGCTTGAACTCAGGAGCTCGAGG - Intergenic
916798327 1:168188895-168188917 TGGTTGAACCCAGGAGCTGGAGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919637916 1:200021310-200021332 AGGTTGAACCCAGGAGATGGAGG + Intergenic
923115444 1:230932854-230932876 AGTGAGAAGCCAGAAGCTCAGGG + Intronic
924425230 1:243944341-243944363 AGGGAGAGCCCCTGAGCTCAGGG + Intergenic
924547078 1:245039389-245039411 TGCTTGAACCCAGGAGCTCGAGG + Intronic
1062909751 10:1205048-1205070 AGGGAGAACCCAGGAGGTCAGGG - Intronic
1064053592 10:12079171-12079193 AGCTTGAACCCAGGAGTTCGAGG - Intronic
1065040022 10:21683828-21683850 TGGGAGAACCCAGGAGGCGGAGG - Intronic
1065829006 10:29597499-29597521 AGGCTGAACCCAGGAGGTGGAGG - Intronic
1068911117 10:62379562-62379584 AGGGAGGACACTGGAGCTCTTGG + Intronic
1069229651 10:65993817-65993839 AGGCTGAACCCAGGAGGTGGAGG - Intronic
1069336350 10:67356045-67356067 AGGGAAAACCCAGGAACTTTGGG - Intronic
1069521822 10:69127796-69127818 AGGCTGAACCCAGGAGGTCGAGG - Intronic
1069555417 10:69394625-69394647 AGGTAGAACCCAGGATCAGGAGG + Intronic
1069959171 10:72069551-72069573 AGGGGGATGCCAGGAGTTCGAGG - Intronic
1070298876 10:75188382-75188404 GGAGGGAACCCAGGAGCTTGGGG - Intergenic
1073377467 10:103048937-103048959 TGGGAGGATCCAGGAGTTCGAGG - Intronic
1073451004 10:103609070-103609092 AGCGTGAGCCCAGGAGTTCGAGG + Intronic
1074855403 10:117469544-117469566 AGGGAGGCTCCAGGACCTCGTGG - Intergenic
1075815783 10:125264057-125264079 AGGGAAGACCCAGGAGCGGGAGG - Intergenic
1076044609 10:127281651-127281673 AGGGAGACCCCAGGGGCTTGTGG + Intronic
1076454223 10:130578310-130578332 ACGGAGATCCCAGGAGCAAGGGG - Intergenic
1076568281 10:131413490-131413512 AGGGAGCAGCCAGGAGCTGAGGG + Intergenic
1077073692 11:690140-690162 ATGGGGAACCCAGGAGGTGGAGG + Intronic
1077821778 11:5752009-5752031 AGGGAGCACCAAGGAGATAGAGG + Intronic
1078144973 11:8716290-8716312 ATGGAGAACACAGGGGCTCTGGG + Intronic
1079102527 11:17550809-17550831 CGGGAGAACCCAGGAACCAGGGG + Intronic
1083247025 11:61436596-61436618 AGGTAGAAGCTAGGAGCTGGGGG + Intronic
1083925485 11:65803646-65803668 AGGGAGACCACAGGTGCCCGGGG + Intergenic
1084568996 11:69948508-69948530 AGGGAAGACCCAGGACCTGGAGG - Intergenic
1087382239 11:97421013-97421035 AGGTAGAACTCAGGAGTTCTAGG - Intergenic
1087840357 11:102914513-102914535 AGGGAAAAGCCAGGAGTTGGTGG - Intergenic
1088787422 11:113194791-113194813 AGGGGAAACCCAGGAGCCCAGGG + Intronic
1091551109 12:1535532-1535554 AGCAAGAGCCCAGGAGCTCAGGG - Intronic
1091850672 12:3694313-3694335 AGGGAGAACACAGGAGGCTGAGG - Intronic
1092073972 12:5657606-5657628 AAGGAAAACCCAGGTGCTCCTGG + Intronic
1092993779 12:13928217-13928239 AGGTTGAACCCAGGAGGTAGAGG + Intronic
1093178205 12:15937054-15937076 AGGCTGAGCCCAGGAGCTTGAGG - Intronic
1095604977 12:44056181-44056203 AGGAAGAACCCAGGAGTTCAAGG - Intronic
1096436111 12:51591860-51591882 GGGAAGAACCCAGGAGCCCTTGG - Intronic
1096735733 12:53652543-53652565 AGGAAGAGCCCAGGAGGTCCAGG - Intronic
1096807363 12:54148855-54148877 AAGGGGCACCCAGGAGCTGGGGG - Intergenic
1097642248 12:62196546-62196568 AGGGAGACCCCAGGAGAGAGAGG + Intronic
1100534421 12:95493390-95493412 AGGAAGAACCTAGGAGTTTGAGG + Intronic
1100573043 12:95860639-95860661 TGCTTGAACCCAGGAGCTCGAGG - Intronic
1100649551 12:96570058-96570080 TGGCTGAACCCAGGAGGTCGAGG - Intronic
1101361731 12:104033899-104033921 TGATAGAACCCAGGAGCTCAAGG - Intronic
1102242636 12:111334616-111334638 AGGGGGCATCCAGGAGATCGTGG + Exonic
1103599308 12:122044032-122044054 AAGGAGCACCCAGGAGCTGAAGG + Exonic
1103654990 12:122463544-122463566 AGCGAGAGCCCAGGTGTTCGAGG + Intergenic
1103870256 12:124086189-124086211 AGGGAGCAGGCAGGAGCTGGAGG - Intronic
1103977423 12:124712438-124712460 AGCTTGAACCCAGGAGTTCGAGG + Intergenic
1104978790 12:132563733-132563755 AGGGGGTGCACAGGAGCTCGGGG - Intronic
1105043183 12:132977807-132977829 TGGGAGAACCCAGGAGTTTGAGG + Intergenic
1105825894 13:24122899-24122921 AGAGATAACCCAACAGCTCGAGG - Intronic
1106315847 13:28592531-28592553 AGGCAGAAACCAGGACATCGAGG - Intergenic
1106458696 13:29949323-29949345 GGGGAGAACCCAGCTGCTCATGG - Intergenic
1109550821 13:63896864-63896886 AGCAAGAACCAAGGAGCTCAGGG + Intergenic
1110233084 13:73186675-73186697 AGCCTGAACCCAGGAGGTCGAGG + Intergenic
1112265409 13:97919254-97919276 TGCTTGAACCCAGGAGCTCGAGG + Intergenic
1112545596 13:100366282-100366304 AGGGAGTATCCAGGAGCTTGGGG + Intronic
1113464268 13:110503180-110503202 ACAGGGAACCCAGGAGCTCCAGG + Exonic
1114182294 14:20377283-20377305 AGGCAGAAGCCAAGAGCTCCTGG + Exonic
1115192737 14:30763327-30763349 AGGTAGAACCCAGGAGGTCAAGG - Intergenic
1115235293 14:31203547-31203569 CGCTTGAACCCAGGAGCTCGAGG + Intronic
1115452125 14:33559924-33559946 CAGGAGAACCCAGGAGGTAGAGG + Intronic
1116698404 14:48204404-48204426 AGGGAGAACCTAGGAGATGGAGG + Intergenic
1118802589 14:69204474-69204496 AGTGGGAGCCCAGGAGGTCGAGG + Intronic
1119067625 14:71545997-71546019 AAGGTGAGCCCAGGAGTTCGAGG + Intronic
1119351670 14:73970907-73970929 CGTGTGAACCCAGGAGCTTGAGG - Intronic
1119380283 14:74224106-74224128 AGGGAGAACCCTGAAGATCTGGG - Intergenic
1119420568 14:74505644-74505666 AGGCTGAACCCAGGAGCTCTCGG + Intronic
1119614929 14:76092727-76092749 AGGAGGAACCCAGAAGCTGGAGG - Intergenic
1120986724 14:90341683-90341705 AGGAAGAGCCCAGGAGGTCGAGG + Intergenic
1121036464 14:90708060-90708082 AGCTAGAACCCAGGAGGTGGAGG + Intronic
1122767511 14:104082224-104082246 GGAGAGAACCCAGGACCGCGAGG - Intergenic
1122850165 14:104523717-104523739 AGGGAGAAAGCAGGAGCAGGCGG + Intronic
1123477099 15:20597945-20597967 AGGGAGACCCCAGGTCCACGTGG - Intergenic
1123640914 15:22402419-22402441 AGGGAGACCCCAGGTCCACGTGG + Intergenic
1124562302 15:30786257-30786279 TGGTTGAGCCCAGGAGCTCGAGG - Intergenic
1124597049 15:31100161-31100183 AGGTTGAACCCAGGAGGTGGAGG - Intronic
1128015066 15:64337430-64337452 AGCTTGAACCCAGGAGTTCGAGG - Intronic
1128115371 15:65101988-65102010 AGGGAGGATGCAGGAGCGCGTGG + Intronic
1128551022 15:68598018-68598040 ATGGAGAACCCAGGAGAAAGAGG + Intronic
1128776143 15:70321940-70321962 AGGGAGATGACAGGAGCACGTGG + Intergenic
1128938050 15:71764884-71764906 AGGAAGAACCCAGGAGAACTTGG - Intronic
1129502280 15:76050887-76050909 AGCGTGAGCCCAGGAGTTCGAGG - Intronic
1130338723 15:82980463-82980485 AGGCAGAACACAGGAGCAAGGGG - Intronic
1130654562 15:85783182-85783204 AGCTTGAACCCAGGAGCTGGAGG - Intronic
1131057682 15:89385335-89385357 AGGGAGAACCCCTGACCTCTAGG + Intergenic
1132032694 15:98451413-98451435 CGGGAGAGCCCAGGAGCTGAAGG - Intronic
1132094151 15:98969672-98969694 AGAGAGAACCCAGGAAAACGAGG + Intronic
1132108271 15:99081672-99081694 AGTGTGAACCCAGGAGGTGGAGG + Intergenic
1132286033 15:100663244-100663266 GGGGAGAAACCAGGAACTCAGGG + Intergenic
1132596325 16:752166-752188 AGGGAGAAGCCACCAGCTCAGGG - Intronic
1132731189 16:1362779-1362801 AGGGAAAGCCCAGGTGCTGGAGG - Intronic
1132887865 16:2190341-2190363 TGGTGGAACCCAGGAGCTCTGGG + Exonic
1132918640 16:2369889-2369911 AGGGAGACCCCTGGAGCTGAGGG - Intergenic
1133730164 16:8571982-8572004 AGGGGGATCCCAGGGCCTCGTGG - Intronic
1134503235 16:14785405-14785427 AGGGAGAACCCAGGCCCACCTGG + Intronic
1134577330 16:15343493-15343515 AGGGAGAACCCAGGCCCACCTGG - Intergenic
1134725115 16:16413000-16413022 AGGGAGAACCCAGGCCCACCTGG + Intergenic
1134942317 16:18298858-18298880 AGGGAGAACCCAGGCCCACCTGG - Intergenic
1135013037 16:18901305-18901327 AGGCTGAACCCATGAGGTCGAGG - Intronic
1135319966 16:21488907-21488929 AGGCTGAACCCATGAGGTCGAGG - Intergenic
1135372799 16:21920395-21920417 AGGCTGAACCCATGAGGTCGAGG - Intergenic
1135404575 16:22189234-22189256 TGGGAGAATCCAGCAGCTGGTGG + Intronic
1135438985 16:22450306-22450328 AGGCTGAACCCATGAGGTCGAGG + Intergenic
1135607579 16:23836880-23836902 AAGGGGAACCCAGGCCCTCGGGG - Intronic
1135640140 16:24112452-24112474 CGCTTGAACCCAGGAGCTCGAGG + Intronic
1135642710 16:24134826-24134848 AGGTTGAGCCCAGGAGTTCGAGG + Intronic
1135998729 16:27273442-27273464 AGGTAGAGCCCAGGAGGTTGAGG + Intronic
1136045006 16:27608599-27608621 AGCTTGAGCCCAGGAGCTCGAGG - Intronic
1136444820 16:30310324-30310346 AGGCTGAACCCATGAGGTCGAGG - Intergenic
1137541212 16:49363214-49363236 AGGCTGAACCCAGGAGTTCAAGG - Intergenic
1137895406 16:52206394-52206416 TGCTTGAACCCAGGAGCTCGAGG + Intergenic
1138077171 16:54053946-54053968 AAAGAGAACCTAGGAGCACGTGG - Intronic
1138348739 16:56335360-56335382 AGCTAGAACCCAGGGGCTCTGGG + Intronic
1138767304 16:59619730-59619752 TGGGAGAAACAAGGAGCTTGAGG - Intergenic
1139223056 16:65204358-65204380 AGGGAGAACCCAAGAGGATGTGG - Intergenic
1139570604 16:67809373-67809395 CAGGAGAACCCAGGAGGTGGAGG + Intronic
1139628232 16:68209281-68209303 AGCTAGAACCCAGGAGGTGGAGG + Intronic
1140013382 16:71158763-71158785 TGGTTGAGCCCAGGAGCTCGAGG - Intronic
1141440484 16:84026571-84026593 AGGCAGTACCCAGGAGGTGGTGG + Intronic
1141548314 16:84787065-84787087 AGGGAGCACCCAGGAGGGCCTGG + Intergenic
1141608138 16:85167205-85167227 AGGGAGCACCCAGGATTCCGGGG + Intergenic
1141707645 16:85676769-85676791 TGTGTGAACCCAGGAGTTCGAGG + Exonic
1142119795 16:88381628-88381650 AGGGAGATCCCAGGACCTGGAGG + Intergenic
1142123718 16:88399927-88399949 AGGCAGACACCAGGAGCTCTGGG + Intergenic
1143645566 17:8227911-8227933 AGTCAGAACCCAGGTGCTCAGGG + Exonic
1143731274 17:8884357-8884379 AGGGAGAAGCCAGGGTCTCGGGG - Intronic
1144328944 17:14207086-14207108 ACGCAGACCGCAGGAGCTCGCGG + Exonic
1144356281 17:14449445-14449467 AGGCAGATCCCTGGAGCTCAGGG - Intergenic
1144408988 17:14981617-14981639 GGAGGGAACCCAGGAGCACGTGG + Intergenic
1144478228 17:15607739-15607761 AGGGAGACCCTAGGGGCTCTGGG - Intronic
1144669608 17:17125543-17125565 AGGAAGATCACAGGAGCTTGAGG + Intronic
1144854262 17:18259249-18259271 AGGCTGAGCCCAGGAGTTCGAGG - Intergenic
1144920066 17:18755967-18755989 AGGGAGACCCTAGGGGCTCTGGG + Intronic
1145210569 17:21010078-21010100 AGGCTGAGCCCAGGAGATCGAGG + Intronic
1146022158 17:29289054-29289076 AGCTTGAACCCAGGAGGTCGAGG + Intronic
1146547845 17:33754450-33754472 AGGAAGCCCCCAGGAGCTCAGGG - Intronic
1147166097 17:38594220-38594242 CGGGAGAAGCCAGGAGAACGCGG - Intronic
1147356789 17:39904770-39904792 AGGGAAAACCCAGAGGCTTGTGG + Exonic
1148528299 17:48364335-48364357 AGGCAAAGCCCAGGAGTTCGAGG - Intronic
1148603127 17:48908847-48908869 AGGTCGAGCCCCGGAGCTCGGGG - Intronic
1149884138 17:60324196-60324218 TGGTTGAACCCAGGAGTTCGAGG + Intronic
1149999819 17:61426845-61426867 AGGCTGAACCCAGGAGCTGGAGG - Intergenic
1150135931 17:62695138-62695160 AGGGAGAGCCCATGAGCTGCTGG + Intergenic
1150697511 17:67418642-67418664 AGCTAGAACCCAGGAGGTGGAGG - Intronic
1150999238 17:70354409-70354431 AGGCAGGACCCAGGAGGTGGAGG - Intergenic
1152134642 17:78496753-78496775 GGGGCGAACCCAGGAGGTGGAGG - Intronic
1152257875 17:79250886-79250908 TGGGAGAACCCGGGAGGTGGAGG - Intronic
1152297953 17:79479270-79479292 AGGGAGAACCCAGGAGCTCGCGG + Intronic
1152303794 17:79509780-79509802 AGGGAGAAGCCAGGAGCCCAGGG + Intronic
1152623827 17:81379422-81379444 GGGCAGAGCCCAGGAGCTGGAGG + Intergenic
1152840794 17:82566793-82566815 AGGGGGAACCCAGGTCCCCGGGG + Intronic
1153792067 18:8587677-8587699 AGCTTGAACCCAGGAGCTGGAGG - Intergenic
1154196128 18:12268478-12268500 TGGGGGAGCCCAGGAGGTCGAGG - Intronic
1154957673 18:21275154-21275176 AGCTTGAACCCAGGAGGTCGAGG + Intronic
1155273846 18:24167185-24167207 AGGGAGCACCCGGGAGCCAGTGG + Intronic
1157414158 18:47488407-47488429 AGGAAGAAAACAGGAGCTTGAGG + Intergenic
1158415206 18:57244306-57244328 AGCTAGAACCCAGGAGGTGGAGG - Intergenic
1159023815 18:63165243-63165265 AGGGAGGAAACAGGAGCTCAGGG + Intronic
1159560061 18:69984200-69984222 AGGGAGAACTCAGGATTTGGGGG - Intergenic
1159710472 18:71751805-71751827 AAGTAAAACCCAGGAGCTTGAGG + Intronic
1159900460 18:74040147-74040169 AGGGAGAACAAAGGGGCTCAAGG - Intergenic
1160017776 18:75157617-75157639 CGGGAGCCCCCAGGAGCTGGAGG + Intergenic
1160842573 19:1152777-1152799 AGGGAGTACCCAGGAGACCCTGG + Intronic
1161528264 19:4770806-4770828 GGGGAGAACCGGGGAGGTCGGGG + Intergenic
1162201108 19:9020896-9020918 AGCTTGAACCCAGGAGCTGGAGG - Intergenic
1163266891 19:16227174-16227196 AGGTAGGACCCAGGACCCCGTGG + Intronic
1163400136 19:17087179-17087201 AGGGAGACCCCAGGGCCTGGAGG + Intronic
1164572593 19:29385179-29385201 AGGGTGAACACAGGAACTGGAGG + Intergenic
1164865288 19:31599504-31599526 CGGTAGAACCCAGGAGGTGGAGG + Intergenic
1164918136 19:32068158-32068180 AGGGAGCCCCCATGAGCTGGAGG + Intergenic
1165078927 19:33296732-33296754 CGGGGGAACCCAGGAGCCCCAGG - Intergenic
1165353640 19:35290984-35291006 AGGGAGAACCCAGGGGGTGAGGG - Intergenic
1165390123 19:35533918-35533940 AGGGAGAACCCAGGGGTGCTGGG + Intronic
1165442309 19:35836339-35836361 AGCTTGAACCCAGGAGGTCGAGG - Intronic
1166225985 19:41395656-41395678 AGGGGGAAACCAGGAGATGGTGG - Intronic
1166232662 19:41434322-41434344 AGCTTGAACCCAGGAGGTCGAGG + Intronic
1166309950 19:41957251-41957273 AGGGTGACCCCAGGACCTGGAGG - Intronic
1166580772 19:43896910-43896932 AGCTTGAACCCAGGAGGTCGAGG - Intronic
1167409024 19:49334106-49334128 AGGGAGCACCCAGGTGCTGGGGG - Intergenic
1167619937 19:50555161-50555183 GGGGAGAAGCCAGCAGCTTGAGG - Intronic
1168463315 19:56580624-56580646 AGAGGGAACCCAAGAGCTCTGGG - Exonic
925738902 2:6987750-6987772 AGGAAGAACCCAGGGGCCAGAGG - Intronic
925933278 2:8728238-8728260 AGGCTGAGCCCAGGAGGTCGAGG + Intronic
926442239 2:12902069-12902091 CGGGAGAGCCCAGGAGTTCAAGG - Intergenic
926801672 2:16665378-16665400 AGAGAGTACCCAGGACCCCGGGG + Intronic
929001762 2:37353946-37353968 AGTGTGAACCCAGGAGGTGGAGG - Intronic
929800192 2:45093158-45093180 AGGGAGAACATTGGAGCTAGTGG + Intergenic
931234888 2:60404925-60404947 AGAGAGACCCCAGGAGGACGAGG + Intergenic
933080529 2:77978862-77978884 TGGGAGATCCCAGGAGCCAGAGG + Intergenic
935049045 2:99508426-99508448 AGAGAGAACCTAGGAGTTTGAGG - Intergenic
936004025 2:108865981-108866003 GGGGAGAAGCTAGGAGCTGGGGG + Intronic
937978170 2:127593944-127593966 GGGCAGCACCCAGGAGCTCAGGG + Intronic
938841464 2:135168850-135168872 AGGGAGAACCTGGGAGGTCCTGG + Exonic
938903771 2:135820000-135820022 AGGGAGAACTTAGGAGCCCTGGG - Intronic
939087496 2:137738976-137738998 AGGGAGAAGCTAGGAGCTGAGGG + Intergenic
939487341 2:142831234-142831256 TGCTTGAACCCAGGAGCTCGAGG - Intergenic
939993901 2:148902211-148902233 AGAGAGAATCCAGGAACACGAGG - Intronic
940533809 2:154912557-154912579 AGGCAGAAGACAGGAGCTAGGGG - Intergenic
942284581 2:174402603-174402625 AGCTTGAACCCAGGAGGTCGAGG + Intronic
943624927 2:190187768-190187790 AGTTTGAACCCAGGAGTTCGAGG + Intronic
944794755 2:203171519-203171541 AGCTTGAACCCAGGAGCTTGAGG + Intronic
944795204 2:203177065-203177087 AGATTGAACCCAGGAGGTCGAGG + Intronic
944857347 2:203780811-203780833 AGGTTGAGCCCAGGAGGTCGAGG - Intergenic
945619806 2:212121313-212121335 AAGGAGAATCCAGGAGGTGGAGG - Intronic
946192196 2:218013524-218013546 AGGGAGATGCGAGGAGCTGGGGG - Intergenic
946952887 2:224896631-224896653 AGGTTGAACCCAGGAGGTGGAGG + Intronic
947615289 2:231552444-231552466 GGTGGGAACCCAGGAGCTTGAGG - Intergenic
1168818112 20:754730-754752 CAGGAGAACCCAGGAGGTGGAGG + Intergenic
1168881004 20:1205967-1205989 CAGTTGAACCCAGGAGCTCGAGG + Intronic
1169973898 20:11302031-11302053 AGGGAGAACCCAGGCACCTGAGG + Intergenic
1169989195 20:11481665-11481687 TGTTAGAACCCAGGAGGTCGAGG - Intergenic
1170007642 20:11686540-11686562 AGGGAGGAGGCAGGAACTCGAGG - Intergenic
1170080471 20:12469268-12469290 AGGAAGACCCGAGGAGCTCAGGG - Intergenic
1171307226 20:24116944-24116966 AGGGAGAAACCAAGATCTGGGGG - Intergenic
1172505846 20:35462041-35462063 AGTGATAAACCAGGAGCTCTTGG + Intronic
1174341129 20:49896178-49896200 AGGCTGAACCCAGGAGGTCAAGG + Intergenic
1174378094 20:50139506-50139528 GGGGAGAACCAGGGAGGTCGGGG - Intronic
1174859987 20:54082106-54082128 TGCATGAACCCAGGAGCTCGAGG + Intergenic
1178092662 21:29181026-29181048 AGCTAGAGCCCAGGAGATCGAGG - Intergenic
1178322495 21:31616092-31616114 AGGCAGAACCCAGGAGGCAGAGG - Intergenic
1178856996 21:36258647-36258669 AGGAAGAGACCAGGAGCTGGAGG - Intronic
1179349783 21:40597588-40597610 AGCTAGAACCCAGGAGGTGGAGG - Intronic
1180890235 22:19282543-19282565 CAGGAGAACCCAGGAGGTGGAGG + Intronic
1181305424 22:21914191-21914213 AGATTGAACCCAGGAGGTCGAGG + Intergenic
1181362774 22:22351414-22351436 ATGGAAAACACAGGAGCTCAGGG + Intergenic
1181365535 22:22374196-22374218 ATGGAAAACACAGGAGCTCAGGG + Intergenic
1181942013 22:26485183-26485205 TGGGAGAAGCAAGGAGCTCCTGG - Intronic
1182367138 22:29786872-29786894 AGGGTGCACCCAGGAGTTGGAGG - Intergenic
1182376515 22:29852580-29852602 AGGTTGAACCCAGGAGATGGAGG - Intergenic
1182388810 22:29972343-29972365 ATGGAGAACCCAGCAGCACCAGG - Intronic
1183360546 22:37380864-37380886 AGGGAGCTCCAAGGAGCTCTAGG - Intronic
1183469775 22:37999116-37999138 TGGGAGAGCCCAGGAACTCAGGG - Intronic
1183718302 22:39547156-39547178 AGGAAGAACACAGGAGCTGCTGG + Intergenic
1184331985 22:43833207-43833229 TGGGAGAAAGCAGGAGCTGGGGG - Intronic
1185010826 22:48313043-48313065 AGGGAGGCCACAGGAGCTCCAGG + Intergenic
1185202184 22:49514358-49514380 CTGGAGAACCCAGGAGCTGGTGG - Intronic
1185396967 22:50597431-50597453 AGGAAGAAACCAAGATCTCGAGG + Intronic
950124215 3:10501672-10501694 AGGGTGAAGCCAGGGGCTAGGGG + Intronic
950411309 3:12839682-12839704 TGGGAAAAACCAGGAGCTCGTGG + Intronic
951560406 3:23960319-23960341 AGCGTGAACCCAGGAGGTGGAGG + Intronic
952417317 3:33101286-33101308 TGCGAGAACCCAGGAGGTGGAGG - Intergenic
952880090 3:37979507-37979529 CAGGAGAACCCAGGAGTTGGAGG + Intronic
954200366 3:49020424-49020446 AGGGTGGACCCAGGACCTCTGGG - Intronic
954403820 3:50334056-50334078 AGGGAGAACCCTGGCTCTCCTGG - Intronic
954776819 3:53026882-53026904 AGGCTGAACCCAGGAGGTCGAGG - Intronic
954872129 3:53775473-53775495 AGGCTGAGCCCAGGAGGTCGAGG + Intronic
954875940 3:53803310-53803332 TGGGAGAAGCCAGGAGCACCCGG + Intronic
958875629 3:99613558-99613580 ATGGATAACCCAGGGACTCGGGG + Intergenic
959537412 3:107501973-107501995 AGGTTGAGCCCAGGAGTTCGAGG - Intergenic
961173582 3:124816222-124816244 AGGGGGAACCCTGGGGCTTGGGG - Intronic
961322139 3:126083775-126083797 GGAGAGAACCCAGGCGCTGGGGG - Intronic
961528120 3:127520846-127520868 AGGCTGAGCCCAGGAGATCGAGG + Intergenic
961766345 3:129214202-129214224 AGCTTGACCCCAGGAGCTCGAGG - Intergenic
961794009 3:129396574-129396596 TGGGAAAAACCAGGAGCTCGTGG + Intergenic
963833965 3:150037533-150037555 CGAGTGAACCCAGGAGCTCAAGG + Intronic
964622698 3:158732577-158732599 AGAGAGAACCCAGGGGCTGCGGG - Exonic
965222385 3:165943232-165943254 AGGTTGAACCCAGGAGTTTGAGG - Intergenic
966807827 3:183820152-183820174 AGGGAGTACCCAGGATCCCCGGG - Intronic
968315701 3:197723261-197723283 CGGGTGAACCCAGGAGATGGTGG - Intronic
968486780 4:866749-866771 ATGGAGAAGCCAGTAGCTCCCGG + Intronic
968490769 4:889523-889545 CTGCAGAACCCAGCAGCTCGAGG + Intronic
968702211 4:2062489-2062511 TGGGAGACCCCAGGGGCTCCAGG + Intronic
969683739 4:8657387-8657409 GGAGAGAACGCAGGAGCACGGGG + Intergenic
969954842 4:10878527-10878549 AGGCTGAACCCAGGAGGTGGGGG - Intergenic
972002366 4:34055008-34055030 AGGAAGAATCCAGGAACTAGGGG + Intergenic
977709788 4:100112063-100112085 TGGGAGAACCCAGGAGGCAGAGG - Intergenic
980054486 4:128066559-128066581 CGGGGGAACCCAGGAGGTGGAGG - Intronic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
981437773 4:144746766-144746788 AGGGAGAACCCAGGAGGTGTAGG - Intergenic
985271604 4:188198717-188198739 CAGGAGAACCCAGGAGGTGGAGG - Intergenic
985520106 5:370253-370275 AGCGAGGGCCCAGGAGGTCGGGG - Intronic
985559917 5:579870-579892 AGGGATTACCCTGGAGCTCACGG - Intergenic
985615918 5:922051-922073 AGGGAGACCCCAGCATCTCAGGG + Intergenic
985666607 5:1184430-1184452 AGGGATAACCCAGGTGCTGCGGG + Intergenic
985670916 5:1206206-1206228 AGGGAGAAGCCAGGTACTGGAGG - Intronic
985975405 5:3416061-3416083 TGGGAGAAGCCAGAAGCTAGTGG - Intergenic
991713367 5:69429758-69429780 AGGTTGAGCCCAGGAGTTCGAGG + Intronic
992174805 5:74139566-74139588 AGGGAGAGCTCAGCAGCCCGTGG - Intergenic
992257263 5:74933441-74933463 AGGGAGAGCACAGGAAATCGGGG + Intergenic
995502954 5:112828534-112828556 AGGAGGATCCCAGGAGCTTGAGG - Intronic
995955643 5:117773291-117773313 TGTGTGAACCCAGGAGTTCGAGG - Intergenic
996202692 5:120696156-120696178 AGTGTGAACCCAGGAGGTGGAGG + Intergenic
996507875 5:124288273-124288295 CAGGAGAACCCAGGAGGTGGAGG - Intergenic
997568298 5:134905954-134905976 AGCGTGAACCCAGGAGATGGAGG - Intronic
997623514 5:135316085-135316107 AGGGTGAAACCAGGAGCCAGTGG - Intronic
997947239 5:138213531-138213553 AGGGAGAAGCCACGACCTCTGGG + Intergenic
998406572 5:141877914-141877936 AAGGAGACTCCAGGAGCGCGCGG - Intronic
998407319 5:141881461-141881483 TGGGAGATGCCAGGAGCTCTAGG + Intergenic
1000413632 5:160960353-160960375 CTGGAGAGCCCAGGAGCTCGAGG - Intergenic
1001105265 5:168847997-168848019 AGAGAGAACCCAGCAGTTGGAGG + Intronic
1002368104 5:178729187-178729209 CGGGAGGAGCCAGGAGCCCGCGG + Intronic
1002385222 5:178860861-178860883 CGGGAGGAGCCAGGAGCCCGCGG - Intronic
1002827202 6:784624-784646 AGGGAGAATCCAGAAGCTTCAGG - Intergenic
1003366852 6:5483125-5483147 AAGGAGAACCCAGCAGTTTGGGG - Intronic
1003514452 6:6806378-6806400 AGGCAGAACCCAGGAGGTGGAGG + Intergenic
1003885996 6:10521981-10522003 AGGCAGGACCCAGGAGGTGGGGG - Intronic
1004133064 6:12939693-12939715 ACCGAGACCCCAGGAGCTAGGGG + Intronic
1004396851 6:15253145-15253167 AGCTTGAACCCAGGAGCTGGAGG - Intronic
1004656135 6:17663343-17663365 CGTGAGAGCCCAGGAGTTCGAGG - Intronic
1005890253 6:30131562-30131584 AGAGGGAACCCAGGAGCCAGTGG + Intergenic
1007082603 6:39118687-39118709 TGGGTGAACCCAGGAGGTGGAGG + Intergenic
1007646155 6:43382801-43382823 AGCTTGAACCCAGGAGCTGGAGG - Intergenic
1008348090 6:50454205-50454227 TGCTTGAACCCAGGAGCTCGAGG + Intergenic
1008975799 6:57425319-57425341 AGGCTGAACCCAGGAGGTGGAGG - Intronic
1009058460 6:58367872-58367894 AAGGGGAACCCAGCAGCTCCAGG + Intergenic
1013451060 6:110281543-110281565 AGGTTGAACCCAGGAGGTAGAGG + Intronic
1014700391 6:124679439-124679461 AGGAAGAAGCCAGGAGCTGGAGG + Intronic
1015753526 6:136585194-136585216 AGCTAGAACCCAGGAGTTAGGGG - Intronic
1015941721 6:138459078-138459100 AAGGAGAACCCAGGAGGTGGAGG - Intronic
1016569186 6:145493102-145493124 AGGGAGAACCCTGGCTCTTGTGG - Intergenic
1016639913 6:146336693-146336715 AGGGAAAAGCCAGGAGGTCAAGG - Intronic
1016963542 6:149696473-149696495 CAGGAGAACCCAGGAGGTGGAGG + Intronic
1018143737 6:160864111-160864133 AGAGAGAACTCTGGAGCTTGGGG - Intergenic
1018414821 6:163591765-163591787 AGGCAGGACCCAGGAGGTGGAGG - Intergenic
1019502265 7:1370155-1370177 ACGGAGACCCCAGGAGCCCTGGG + Intergenic
1020831250 7:13098429-13098451 AGCTAGAGCCCAGGAGTTCGAGG - Intergenic
1023031347 7:36092744-36092766 AGGGAGAACTCATGAGATTGTGG + Intergenic
1023154596 7:37235834-37235856 AGGCTGAACCCAGGAGGTGGAGG + Intronic
1023169120 7:37373523-37373545 AGGTTGAACCCAGGAGGTGGGGG + Intronic
1023600813 7:41880276-41880298 GGGGAGAAACCAGAAGGTCGGGG + Intergenic
1024094965 7:45976087-45976109 AGGGAGATGGCAGGAGCTTGTGG + Intergenic
1024486315 7:49924716-49924738 AGGGAGAACCCAGGAGAAATGGG - Intronic
1024801728 7:53087305-53087327 AGGGAGAGGCAAGGAGCTAGGGG + Intergenic
1025982430 7:66417931-66417953 AGGTTGAACCCAGGAGGTGGAGG - Intronic
1026290007 7:68997756-68997778 AGGCAGAACCCAGGAGGCAGAGG - Intergenic
1026826792 7:73587524-73587546 AGGCTGAGCCCAGGAGTTCGAGG - Intergenic
1028541493 7:91947424-91947446 AGCTAGAACCCAGGAGGTGGAGG - Intronic
1029182863 7:98717080-98717102 AGGCAGAACCCAGGAGGCAGAGG - Intergenic
1029319300 7:99743347-99743369 GGGGAGACACCAGGAGCTCTGGG + Intergenic
1029548307 7:101222847-101222869 TGGGAGGACCCAGGAGCTCCTGG + Intronic
1029705145 7:102272204-102272226 AGTGGGAACCCAGGAGCATGTGG + Intronic
1031367670 7:120923331-120923353 AGCTTGAGCCCAGGAGCTCGAGG - Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1033188174 7:139249787-139249809 AGGAGGAACCCAGGAGGTTGAGG - Intronic
1033228671 7:139580246-139580268 AGGGAGAAACACTGAGCTCGAGG + Intronic
1035378487 7:158423366-158423388 GGGGAGCACCCATGACCTCGTGG + Intronic
1035608758 8:947188-947210 AAGAACAACCCAGGAGCCCGGGG + Intergenic
1036398122 8:8386105-8386127 CGGGAGGACCGAGGAGCTGGAGG - Intronic
1036815346 8:11898391-11898413 AGGGAGAAGCCAGCACCACGTGG - Intergenic
1038774699 8:30518348-30518370 TGGTAGAATCCAGGACCTCGAGG + Intronic
1039175048 8:34794017-34794039 AGGTTGAGCCCAGGAGTTCGAGG + Intergenic
1039594336 8:38777709-38777731 TGCTAGAGCCCAGGAGCTCGAGG + Intronic
1040430523 8:47337209-47337231 AGGTTGAACCCAGGAGGTCGAGG - Intronic
1041067023 8:54091984-54092006 AGGCTGAACCCAGGAGGTCAAGG + Intronic
1041466227 8:58160082-58160104 AGGAAGGAGCAAGGAGCTCGAGG - Intronic
1042060663 8:64813694-64813716 TGGGATAACTCAGAAGCTCGTGG + Intergenic
1042868573 8:73377386-73377408 AGTGAGAAGCCAGGAGAGCGTGG - Intergenic
1043462141 8:80471143-80471165 TGTGAGAACCCAGGAGGTGGAGG - Intergenic
1045116906 8:98992596-98992618 TGGTTGAACCCAGGAGCTGGAGG - Intergenic
1045121057 8:99035099-99035121 TGGGAGAGCCCAGGAGTTTGAGG + Intronic
1045295901 8:100871565-100871587 AGGGGGAGCCCAGGAGGTTGAGG + Intergenic
1045326315 8:101120104-101120126 TGGCTGAACCCAGGAGGTCGAGG + Intergenic
1047246681 8:123152285-123152307 AGGGAGAACTCAGCAGCAGGTGG + Intergenic
1047647408 8:126883260-126883282 ATGAAGAACCCAGGAGCATGAGG - Intergenic
1052689478 9:31799347-31799369 AGGCAGAACCCAGGAGTTGGTGG - Intergenic
1055064715 9:72107281-72107303 CAGGAGAACCCAGGAGGTGGAGG + Intergenic
1055696181 9:78887145-78887167 TGCTTGAACCCAGGAGCTCGAGG - Intergenic
1056659515 9:88534371-88534393 CGGGAGAGCCCAGGGGCGCGAGG + Intergenic
1056951648 9:91044829-91044851 ACGCAGAACCCTGGAGCTCAAGG - Intergenic
1057411958 9:94824613-94824635 AGGGTGGAACCAGGAGCTCATGG + Intronic
1059064101 9:111064546-111064568 ACTGAGAACCCTGGAGCTCATGG + Intergenic
1059318518 9:113447939-113447961 AGCTTGAACCCAGGAGGTCGAGG - Intronic
1061015898 9:127980695-127980717 AGGGGGCTGCCAGGAGCTCGGGG + Intergenic
1062286988 9:135777747-135777769 AGGGAGGACCCAGGAGCCAGAGG - Intronic
1062340265 9:136090966-136090988 TGGGCGGGCCCAGGAGCTCGCGG + Intronic
1185470705 X:381017-381039 AGGAAGATCCCAGGAGTTCGAGG - Intronic
1185590376 X:1272569-1272591 CGGGTGAACCCAGGAGGTGGAGG - Intronic
1185861682 X:3585206-3585228 AGGGAGAAACCAAGAGATAGTGG - Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1188003698 X:25003464-25003486 CGGGAGAGCCCAGGTGCGCGTGG + Intergenic
1188994929 X:36872496-36872518 CGCTTGAACCCAGGAGCTCGAGG + Intergenic
1192263611 X:69523909-69523931 AGGAAGAACCCTGGAGTTGGAGG + Intronic
1192442511 X:71185120-71185142 AGGTAGGACGCAGGAGCTGGGGG + Intergenic
1196029896 X:111085581-111085603 ACTGAGAACCCTGGAGGTCGTGG + Intronic
1197962511 X:132022684-132022706 AGGGATAGCCCAGGAGGTAGGGG + Intergenic
1201689508 Y:16747307-16747329 AGGGAGAACACAGGAACACAGGG - Intergenic
1201967824 Y:19757604-19757626 AGGAGGAACCCAGGAGGTGGAGG - Intergenic