ID: 1152298397

View in Genome Browser
Species Human (GRCh38)
Location 17:79481631-79481653
Sequence TGGCTCGGGGAGCTTGCGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152298391_1152298397 17 Left 1152298391 17:79481591-79481613 CCTCAGGGGAGCAGAGAGGGCTA 0: 1
1: 0
2: 2
3: 20
4: 253
Right 1152298397 17:79481631-79481653 TGGCTCGGGGAGCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 95
1152298389_1152298397 20 Left 1152298389 17:79481588-79481610 CCACCTCAGGGGAGCAGAGAGGG 0: 1
1: 0
2: 6
3: 39
4: 345
Right 1152298397 17:79481631-79481653 TGGCTCGGGGAGCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 95
1152298386_1152298397 22 Left 1152298386 17:79481586-79481608 CCCCACCTCAGGGGAGCAGAGAG 0: 1
1: 0
2: 5
3: 56
4: 405
Right 1152298397 17:79481631-79481653 TGGCTCGGGGAGCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 95
1152298387_1152298397 21 Left 1152298387 17:79481587-79481609 CCCACCTCAGGGGAGCAGAGAGG 0: 1
1: 1
2: 13
3: 82
4: 464
Right 1152298397 17:79481631-79481653 TGGCTCGGGGAGCTTGCGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152298397 Original CRISPR TGGCTCGGGGAGCTTGCGGT TGG Intronic
900763156 1:4486473-4486495 TGGCCATGGGAGCTTGTGGTGGG - Intergenic
902711276 1:18241644-18241666 TGGCTTGGGGAGCCTGTGGCAGG + Intronic
903249868 1:22045056-22045078 TGCCCCTGGGAGCTTGCAGTAGG + Intergenic
903995159 1:27300876-27300898 GGGCTTGGGGAGCCTGTGGTGGG + Intronic
914515870 1:148373608-148373630 TGGCTGGAGGAGGTTGCAGTGGG + Intergenic
915361312 1:155287880-155287902 TGGCTCGGGGTGTTCGGGGTCGG + Exonic
919631550 1:199964843-199964865 AGGCTTGGGTAGCTTGCAGTAGG - Intergenic
919758938 1:201084897-201084919 TGTCTCAGGGAGCTGGGGGTTGG + Intronic
920860097 1:209698911-209698933 TGGCACGTGTAGCTTGTGGTAGG - Intronic
922535166 1:226374292-226374314 TGGCTTGGGGAGCTTGGACTTGG + Exonic
923533346 1:234829197-234829219 TGGCTCAGGGTCCTGGCGGTTGG - Intergenic
1063292505 10:4763877-4763899 TGGCTTGGGGAGCTGGAGGCAGG - Intergenic
1067552429 10:47245169-47245191 TGGCAGGGGGAGGGTGCGGTGGG + Intergenic
1072724450 10:97803308-97803330 TGGCTTGGGGAGGTTGGGGCTGG + Intergenic
1074119844 10:110485878-110485900 TGGCTTTGGGAGATTGCGGATGG - Intergenic
1075275614 10:121090005-121090027 TGGCTGGTGGAGGTTGAGGTGGG - Intergenic
1075653739 10:124147489-124147511 GAGCTTGGGGAGCTTGGGGTGGG - Intergenic
1076351996 10:129823264-129823286 TGGGAGGGGGAGCTTGCAGTGGG - Intergenic
1077368043 11:2169157-2169179 TGGCTCTGGGAGCTGGGGGGCGG + Intronic
1081651445 11:44826820-44826842 TGCCTTGGGGAGCCTGGGGTAGG + Intronic
1083598281 11:63930460-63930482 TGGCAGGGGGAGGTTGCAGTGGG + Intergenic
1088673441 11:112167230-112167252 TGGCTCTGGGAGGCTACGGTGGG + Intronic
1091302748 11:134518023-134518045 AGCCTCTGGGAGCTTGGGGTGGG - Intergenic
1104950614 12:132438232-132438254 TGGCGGTGGGAGCGTGCGGTGGG - Intergenic
1108444943 13:50498697-50498719 TGGGAGGGGGAGGTTGCGGTGGG + Intronic
1110125862 13:71941516-71941538 TGGCTTTGGGAGCAGGCGGTAGG + Intergenic
1112197494 13:97240139-97240161 TGACTCGGGGAGTCTGAGGTGGG + Intronic
1115521977 14:34241998-34242020 TGGCTCAGGGAGCCTGCAGAGGG - Intronic
1119725099 14:76917547-76917569 TGCCTTGGGGAGCTTGCATTAGG + Intergenic
1121814609 14:96919714-96919736 TGGCTCGGGGAGCTGGAGACGGG - Intronic
1124008319 15:25812013-25812035 TGGAACGGGGAGCGTGCGCTGGG - Intronic
1126980691 15:54239288-54239310 TGGGTAGGGGAGCTTGCTGATGG - Intronic
1129387589 15:75204242-75204264 TGGCTGGGGGAGGTAGAGGTAGG + Intronic
1129696464 15:77743154-77743176 TGGCAGGGGGAGCATGGGGTAGG - Intronic
1129751396 15:78067287-78067309 TGGCTCTGGGAGCTGGAGGAAGG - Intronic
1132519967 16:382320-382342 AGGCTCGGGGAGCCCGCGGGGGG + Intronic
1132668242 16:1091474-1091496 TGGCTGGGAGAGCTTCCGGGAGG + Intronic
1132875588 16:2135616-2135638 TGGCTCGGGGCGCTGGCGGGGGG - Exonic
1134022313 16:10929643-10929665 AGGCTCGGGAGGCTTGGGGTGGG + Exonic
1134519398 16:14911737-14911759 TGGCTCGGGGCGCTGGCGGGGGG + Intronic
1134554535 16:15154491-15154513 TGGCTCGGGGCGCTGGCGGGGGG - Intergenic
1134707068 16:16310392-16310414 TGGCTCGGGGCGCTGGCGGGGGG + Intergenic
1134960472 16:18401732-18401754 TGGCTCGGGGCGCTGGCGGGGGG - Intergenic
1137551044 16:49437769-49437791 TGTCTTGGGGAACTTGGGGTAGG - Intergenic
1138439727 16:57026751-57026773 TGGCCCTGTGAGCTTGCGGGTGG - Exonic
1139435430 16:66934175-66934197 GGGTTCCGGGGGCTTGCGGTGGG - Intronic
1141683312 16:85556435-85556457 TGGCTCGGGGGTCTGGCGGAGGG - Intergenic
1142950249 17:3472320-3472342 GGGCTGCGGGAGCTTGCGGGAGG + Intronic
1146260107 17:31415416-31415438 TGGCTTGGGGACCTTGGAGTGGG - Intronic
1147670343 17:42173384-42173406 GGGCTCTGGGAGCTGGGGGTAGG - Intronic
1150299793 17:64038497-64038519 TGGCAGGTGGAGCTTGCGGAGGG + Intergenic
1152298397 17:79481631-79481653 TGGCTCGGGGAGCTTGCGGTTGG + Intronic
1153051432 18:906049-906071 TGTCTTGGGGGGCGTGCGGTGGG + Intronic
1160151988 18:76402313-76402335 TGGCTCTGGGAGGTTACGGGAGG - Intronic
1161612570 19:5251290-5251312 TGGCGGAGGGAGCTGGCGGTGGG - Intronic
1161768293 19:6218545-6218567 TGTCTTGGGCAGCTGGCGGTAGG - Intronic
1162066970 19:8131730-8131752 TGCCTGGGGGGGCTGGCGGTAGG - Exonic
1163027155 19:14518832-14518854 TGTCTCGTGGGGCCTGCGGTGGG + Intronic
1166694878 19:44846699-44846721 GGGCTCGGGGAGCCGGGGGTGGG - Intronic
1168173951 19:54609300-54609322 TGGCTCGGGGACACTGAGGTGGG - Intronic
925130048 2:1488354-1488376 AGGCTCTGGGACCTTGTGGTGGG - Intronic
925262601 2:2541601-2541623 TGGTTCTGGGAGCTTTCTGTGGG - Intergenic
933700595 2:85252720-85252742 GGCCTCGGGGAGCTTGTGGTAGG - Intronic
1169375209 20:5061424-5061446 TGACTCAGGGAGTTTGGGGTGGG - Intergenic
1172240828 20:33411486-33411508 TGGCTGGGGGAGGTGGAGGTGGG - Intronic
1172354262 20:34268842-34268864 TGACTGGGGGAGCGGGCGGTGGG + Intronic
1173514838 20:43657834-43657856 AGGCTGGAGGAGCTTGCGGTTGG + Intergenic
1176008124 20:62877175-62877197 AGGCTCGGGGAGCTGGCGCCTGG - Intergenic
1179176347 21:39010774-39010796 TGGCTAGGGGAGCTGGAGGGAGG - Intergenic
1184070748 22:42144769-42144791 GGGCTTGGGGAGCTTGGAGTGGG - Intergenic
950712714 3:14824375-14824397 TGCCTAGGGGTGCTTGGGGTTGG + Intronic
953097796 3:39795746-39795768 TGGCATGGGAAGCTGGCGGTGGG + Intergenic
954607861 3:51928179-51928201 TGGGAGGGGGAGGTTGCGGTGGG - Intergenic
954937361 3:54338802-54338824 TGGCTCGTGGGGCTTGAGGAAGG + Intronic
959085769 3:101849534-101849556 TGGCTCAGGGAGCTGTCGGCGGG - Exonic
969791117 4:9494478-9494500 TGCCTCACGGAGCATGCGGTAGG + Intergenic
972827735 4:42780445-42780467 TGGCTTTGGGGGCTTGGGGTGGG - Intergenic
974410757 4:61538850-61538872 TGGCTGGGGAAGATTGCGTTGGG + Intronic
974656284 4:64826957-64826979 TGGCAGGCGGAGCTTGCAGTGGG - Intergenic
975814631 4:78205033-78205055 TGGGTGGTGGAGCTTGAGGTGGG + Intronic
977140428 4:93364723-93364745 TGGCTTTGGGAGGTTGAGGTGGG - Intronic
981817177 4:148843836-148843858 TGGCTGGGGGAGCTTGTGACTGG + Intergenic
985646120 5:1085532-1085554 TGGCGCTGGGGGCTTGCGGGAGG - Intronic
990323061 5:54648665-54648687 TGGCTCGGGCAGCCTGCGTTTGG + Intergenic
992179492 5:74182818-74182840 TGGCTCGGGGAGCGTCTGTTAGG + Intergenic
993613306 5:90080691-90080713 TTGCTAGGGGAGGTTGAGGTGGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
999144959 5:149386274-149386296 TGGCTCAGGGAGCTTGGGGCTGG + Intronic
1013652110 6:112205917-112205939 AGGCTTGGGGGGCTTCCGGTTGG + Intronic
1023082008 7:36534524-36534546 TGGCTAGGGGTGCTTGCGATGGG + Intronic
1026041569 7:66872723-66872745 TGGGAGGTGGAGCTTGCGGTGGG - Intergenic
1026464888 7:70645400-70645422 TGGCTGGTGCAGCTTCCGGTTGG - Intronic
1026531989 7:71207557-71207579 TGGCTCGGGTGGGTTGGGGTAGG + Intronic
1041474797 8:58252037-58252059 TGGCTTGGGGCACTTGTGGTAGG - Intergenic
1045243519 8:100422890-100422912 TGGCTAAGGGGGCTTGGGGTGGG + Intergenic
1053119982 9:35539112-35539134 TGGCTCAGGGAGCTGGGGGAGGG + Intronic
1053542960 9:38993730-38993752 TGGCACGGGGAGACTGCAGTGGG + Intergenic
1053807403 9:41817247-41817269 TGGCACGGGGAGACTGCAGTGGG + Intergenic
1054623189 9:67370180-67370202 TGGCACGGGGAGACTGCAGTGGG - Intergenic
1059777170 9:117487651-117487673 TGGCCCGGGGAGCTTGGGTGGGG + Intergenic
1061800678 9:133112028-133112050 TGGCTCGGGGTGAGTGCGCTCGG - Exonic
1062391019 9:136333896-136333918 TGGCTGGGAGAGCTTGGGGGTGG + Intronic
1203773711 EBV:61612-61634 CGGCTCGTGGGGCTCGCGGTGGG + Intergenic
1189505391 X:41608401-41608423 TGGCTCTGGGAGGTTGCTATGGG - Intronic
1192779254 X:74277515-74277537 AGGCTCTGGGAGCTTAGGGTGGG + Intergenic
1198506194 X:137303446-137303468 TGGGTCGGGGAGGCTGGGGTGGG + Intergenic