ID: 1152301818

View in Genome Browser
Species Human (GRCh38)
Location 17:79499276-79499298
Sequence ATGAATAAATGGATGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1366
Summary {0: 1, 1: 2, 2: 26, 3: 197, 4: 1140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152301818 Original CRISPR ATGAATAAATGGATGGTAGA TGG (reversed) Intronic
900081513 1:861849-861871 ATAAATAGATGGATGATGGATGG + Intergenic
900081529 1:862063-862085 ATAAATAGATGGATGATGGATGG + Intergenic
900498136 1:2985870-2985892 GTGAATGAATGGATGGATGATGG - Intergenic
900498155 1:2985958-2985980 GTGAATGGATGGATGGTGGATGG - Intergenic
900498161 1:2985984-2986006 ATGGATGGATGGATGGTAGATGG - Intergenic
900498167 1:2986011-2986033 GTGAATGAATGGATGGAGGATGG - Intergenic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900498757 1:2989418-2989440 ATGGATAACTGGATGGTGGATGG - Intergenic
900498784 1:2989543-2989565 ATGGATGAATGGATGGAGGATGG - Intergenic
900498790 1:2989569-2989591 ATGGACAAATGGATGGAAGATGG - Intergenic
900509584 1:3052193-3052215 ATGAATGAATGGATGGATGATGG - Intergenic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
900573347 1:3370883-3370905 ATGGATGAATGGATGGTGGATGG - Intronic
900573359 1:3370946-3370968 ATGAATCGATGGATGGTGAATGG - Intronic
900573384 1:3371060-3371082 ATGGTTGAATGGATGGTGGATGG - Intronic
900573396 1:3371123-3371145 ATGAATCAATGGATGGTGAATGG - Intronic
900573426 1:3371253-3371275 ATGGATGAATGGATGGTGGATGG - Intronic
900573442 1:3371339-3371361 ATGAATGGATGGATGGTGAATGG - Intronic
900896802 1:5488332-5488354 ATGGATGAATGGATAGTTGAAGG - Intergenic
900922029 1:5678924-5678946 ATGAATGGATGGATGAGAGATGG + Intergenic
900930959 1:5737211-5737233 ATGGATGGATGGATGATAGAGGG + Intergenic
900931027 1:5737700-5737722 ATATATGAATGGATGGTGGATGG + Intergenic
901001214 1:6149651-6149673 ATGGATAAATGGATGATGGATGG + Intronic
901001301 1:6150163-6150185 ATGGACAAATGGATGATGGATGG + Intronic
901001369 1:6150510-6150532 ATGGATGGATGGATGGTGGATGG + Intronic
901006541 1:6174414-6174436 ATGGATGAATGCATGGTGGATGG + Intronic
901006548 1:6174467-6174489 ATGGATAGATGGTGGGTAGATGG + Intronic
901006562 1:6174525-6174547 ATGGATGGATGGATGGCAGATGG + Intronic
901006601 1:6174699-6174721 ATGGATGAATGGATGGTGGATGG + Intronic
901006658 1:6174983-6175005 ATGGATGGATGGATGGCAGATGG + Intronic
901006675 1:6175066-6175088 ATGGATGAGTGGATGGTGGATGG + Intronic
901006719 1:6175276-6175298 ATGCATGGATGGATGGTGGATGG + Intronic
901006723 1:6175299-6175321 ATGAATGAATGGATGGTGGATGG + Intronic
901006731 1:6175341-6175363 ATGGATGAGTGGATGGTGGATGG + Intronic
901006736 1:6175364-6175386 ATGCATGGATGGATGGTGGATGG + Intronic
901180810 1:7340605-7340627 ATGCATAAATGGATAGGTGACGG - Intronic
901304305 1:8221571-8221593 ATGAACACCTGGATGGCAGAAGG + Intergenic
901940632 1:12658989-12659011 ATGAATAGATGGATGGATGGGGG + Intronic
902149804 1:14434153-14434175 ATAAATAAATGGATCCTAGTGGG - Intergenic
902154667 1:14475060-14475082 ATGGATAGATGAATGGTAGATGG + Intergenic
902398004 1:16142926-16142948 ATGAGTAGATGGATGGATGAGGG + Intronic
902599040 1:17528624-17528646 ATGAATGAATGGATGGAGGATGG - Intergenic
902721184 1:18305246-18305268 ATGGATGCATGGATGGTGGATGG + Intronic
902721233 1:18305529-18305551 ATGAATGGATGGATGGATGATGG + Intronic
903277511 1:22231388-22231410 ATGGATGAATGGATGATGGATGG - Intergenic
903357842 1:22758937-22758959 ATGAATGGATGGATGGATGATGG + Intronic
903369156 1:22824167-22824189 ATGAATACATGGATCATAGATGG + Intronic
903474263 1:23608541-23608563 ATGAATGAATGGATGAATGAAGG + Intronic
904391050 1:30186365-30186387 ATGAATAAATAGGGGGTGGATGG - Intergenic
904393358 1:30199965-30199987 GTGAATTAAAGGATGTTAGAGGG + Intergenic
904929001 1:34071597-34071619 ATGACTTAGTGGAAGGTAGATGG - Intronic
905782590 1:40725619-40725641 AAAAATAAATGGATGGATGAGGG - Intronic
906240923 1:44241859-44241881 ATGGACAGATGGATGGAAGAAGG - Intronic
906486228 1:46237484-46237506 ACAAATAAATTGAAGGTAGATGG + Intergenic
906580510 1:46931376-46931398 ATGAGTGAAAGGATGGTTGATGG + Intronic
906798393 1:48715363-48715385 ATGAATGAATGAATGATTGAAGG - Intronic
907690296 1:56657738-56657760 ATAAATAAATGAATGAAAGAAGG + Intronic
907790129 1:57655368-57655390 ATGAATGGATGGATGGATGATGG - Intronic
908005484 1:59723413-59723435 TTAAGTAAATGGATGGCAGATGG - Intronic
908044071 1:60149371-60149393 ATGATTAAATGAATGGCAGCAGG - Intergenic
908391400 1:63686850-63686872 ATGGATGAATGGATGGGGGATGG - Intergenic
908391416 1:63686913-63686935 ATGAAGAAGTGGATGGAAGAAGG - Intergenic
908923502 1:69224813-69224835 ATGAATAAGTGAAGGATAGATGG - Intergenic
909535179 1:76728016-76728038 ATAACAAAATGAATGGTAGAGGG - Intergenic
909885493 1:80937269-80937291 AGGAATAAATGAATAGCAGAAGG + Intergenic
910094652 1:83507425-83507447 ATGTATATATGGTTGGTGGAGGG + Intergenic
910331651 1:86079565-86079587 ATGAATAACTAGAATGTAGAAGG + Intronic
910573135 1:88728679-88728701 TTCAGTAAATGGATGGTAGATGG + Intronic
911160058 1:94675073-94675095 ATGAATAATTGGATGATAAGTGG + Intergenic
911168773 1:94748203-94748225 ATGAGTGAATGAATGGCAGAGGG + Intergenic
911429246 1:97762471-97762493 ATGAACAAATAGCTGATAGAAGG + Intronic
911627331 1:100139517-100139539 ATGAAGAAATGAATGGAGGAAGG + Intronic
911710462 1:101065840-101065862 ATGAAAATGGGGATGGTAGAGGG - Intergenic
912380278 1:109243861-109243883 ATGAATACATGAATGGAGGATGG - Intergenic
912568212 1:110604186-110604208 ATGAAGACATGCATGGTAGTGGG - Exonic
913970459 1:143411404-143411426 ATGAATGAATGAATGAAAGAAGG + Intergenic
914351375 1:146843022-146843044 ATGGATGAATGGATGATGGATGG + Intergenic
915073232 1:153289237-153289259 ATGAATTTATGGCTGGCAGAAGG + Intergenic
915116063 1:153600520-153600542 ATAAATAAATGGATGGTGGAGGG - Intergenic
916634025 1:166648763-166648785 ATGACAAAATTCATGGTAGAAGG - Intergenic
917261007 1:173169389-173169411 TTGAATAAATATATGGTAGAGGG - Intergenic
917466428 1:175281256-175281278 TTAAGTAAATGGATGGCAGATGG + Intergenic
917658698 1:177155627-177155649 TTAAATACATGGATGGTAGATGG + Intronic
917694570 1:177508676-177508698 ATGAATAAATGAAAGAAAGAAGG + Intergenic
917743165 1:177981489-177981511 ATGAATAAATGGTGGACAGATGG - Intronic
917859696 1:179134478-179134500 ATAAATAACTTGATGGTGGAAGG - Intronic
918371692 1:183867599-183867621 ATAGAGAAATGGATGGAAGATGG + Intronic
918823048 1:189284255-189284277 ATGAATAAATGAATGAAATAGGG - Intergenic
919123705 1:193371600-193371622 ATGGGTTAATGGATGGAAGAGGG + Intergenic
919545140 1:198907045-198907067 ATGAATAAATTAATAATAGAGGG - Intergenic
919922272 1:202173655-202173677 ATGGATGGATGGATGGTGGATGG - Intergenic
920624387 1:207582337-207582359 ATGACTAAATGGATGATTGAGGG - Intronic
920722271 1:208398896-208398918 ATGAATGAATGAATGGATGATGG - Intergenic
920730943 1:208483867-208483889 ATGGATAAATGAATGGTAAGGGG - Intergenic
921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG + Intronic
922123270 1:222696536-222696558 ATTAATACTTGGATGGGAGAAGG - Intronic
922745544 1:228041379-228041401 ATGGATGAATGGATGATGGATGG - Intronic
922745570 1:228041547-228041569 ATGAATTGATGGATGGTGGATGG - Intronic
922745787 1:228042865-228042887 ATGGATAGATGGGTGGTGGATGG + Intronic
922790588 1:228308821-228308843 ATAAATAGATGGATTGTGGATGG - Intronic
922790891 1:228310379-228310401 GTGAATGGATGGATGGTGGATGG - Intronic
922790926 1:228310593-228310615 ATGGATAGATGGATAGTAAATGG - Intronic
922792838 1:228319638-228319660 ATGGATAGATGAATGGTGGATGG - Intronic
922792858 1:228319739-228319761 ATGAATGGATGAATGGTGGATGG - Intronic
922792900 1:228320017-228320039 ATGGATGGATGGATGGTAGATGG - Intronic
922848284 1:228708073-228708095 ATGAATAAAATGAAGGGAGAAGG + Intergenic
923301440 1:232644323-232644345 ATGGATAGATGGATGGATGAAGG - Intergenic
923984336 1:239363955-239363977 ATGAGTAAATGGATGGTTGGGGG + Intergenic
924006814 1:239621246-239621268 ATGAAGAAATGGGTGGTTGGTGG - Intronic
924034300 1:239920405-239920427 ATGGATGAATGGATGATGGATGG - Intergenic
924435164 1:244033108-244033130 CTGAATAATTGCATGGAAGAGGG + Intergenic
1062800089 10:372557-372579 ATGAATAAATGTACAGTGGAAGG - Intronic
1062940175 10:1415011-1415033 ATGGATAGATGGATGATAGATGG + Intronic
1062943868 10:1445125-1445147 GTGAGTGAATGGATGGTAAATGG - Intronic
1063092255 10:2875680-2875702 ATAAATAAATTGATAATAGATGG + Intergenic
1063438926 10:6056287-6056309 ATGCATGAATGGATGGATGAAGG + Intronic
1063500446 10:6548962-6548984 ATGGATAAATGGATCATGGATGG - Intronic
1064132361 10:12721505-12721527 ATGGATGGATGGATGGTGGATGG - Intronic
1064698503 10:17992207-17992229 ATGGATAGAGGGATGATAGATGG + Intronic
1065304836 10:24358068-24358090 ATGAATGAAAGGCTGGAAGAAGG - Intronic
1065397733 10:25258242-25258264 ATGAATAAGTGAATGAGAGAAGG - Intronic
1065801000 10:29352258-29352280 ATGAATCAAGGGATGATTGAGGG + Intergenic
1065860679 10:29870336-29870358 ATGGATGGATGGATGGTGGATGG - Intergenic
1065860704 10:29870447-29870469 ATGAATGGATAGATGGGAGATGG - Intergenic
1065860728 10:29870550-29870572 ATGAATGAGTGGATGGTAGATGG - Intergenic
1065860736 10:29870603-29870625 ATGAATGGATCGATGGTAGATGG - Intergenic
1065860770 10:29870778-29870800 ATGAATGGATGGATGGTAAATGG - Intergenic
1065860789 10:29870885-29870907 ATGAATGGATGGATGGTAGATGG - Intergenic
1065860810 10:29871009-29871031 ATAAATGGATGGATGGTAGATGG - Intergenic
1066229330 10:33416895-33416917 ATGAATGGATGGATGGTGGATGG + Intergenic
1066556597 10:36621218-36621240 ATGAAGAAATGAAGGGAAGAAGG - Intergenic
1066573410 10:36798928-36798950 ATGAATAAATGAATGAATGAGGG + Intergenic
1066610270 10:37238310-37238332 AAAAATAAATAAATGGTAGAAGG - Intronic
1067051422 10:43023554-43023576 ATGGATGAATGGATGGATGATGG + Intergenic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1067342442 10:45416800-45416822 ATGGATTCATGGATGGTGGATGG + Intronic
1067808240 10:49407934-49407956 ATGAAAAAATGGATGGATGAAGG + Intergenic
1067833704 10:49624952-49624974 ATGGATATATGGATGGATGATGG + Intronic
1069618660 10:69822627-69822649 ATGAACAAATGAATGGTGGGTGG - Intronic
1070580371 10:77714448-77714470 GTGAATGAATGAATGGTTGATGG - Intergenic
1070612545 10:77943466-77943488 ATGAATAAATTAATGACAGAGGG + Intergenic
1070638717 10:78150234-78150256 ATGAATGAATGAATTGCAGAAGG - Intergenic
1071131212 10:82395660-82395682 ATGAATGGATGGATGATGGATGG - Intronic
1071382378 10:85080612-85080634 TTAAATAACTGGATGGCAGATGG + Intergenic
1071509032 10:86249872-86249894 ATAAATGGATGGATGGTGGAAGG + Intronic
1072450411 10:95535058-95535080 ATAAATGAATGGATGGATGATGG + Intronic
1072484792 10:95844722-95844744 ATGAATGAATGAATGATAGATGG + Intronic
1073467170 10:103700964-103700986 ATGGATGGATGGATGGTGGATGG - Intronic
1073467179 10:103701013-103701035 ATGGATGGATGGATGGTGGATGG - Intronic
1073467185 10:103701036-103701058 ATGGATGGATGGATGGTGGATGG - Intronic
1073467198 10:103701100-103701122 ATGGATGGCTGGATGGTAGATGG - Intronic
1073467213 10:103701172-103701194 ATGGATGGATGGATGGTGGATGG - Intronic
1073467222 10:103701217-103701239 ATGGATGGCTGGATGGTAGATGG - Intronic
1073467235 10:103701288-103701310 ATGAATGGATGGATGATGGATGG - Intronic
1073467236 10:103701292-103701314 ATGGATGAATGGATGGATGATGG - Intronic
1073467239 10:103701311-103701333 ATGAATGGATGGATGATGGATGG - Intronic
1073467240 10:103701315-103701337 ATGGATGAATGGATGGATGATGG - Intronic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1073467274 10:103701484-103701506 ATGAATGGATGGATGATGGATGG - Intronic
1073467275 10:103701488-103701510 ATGGATGAATGGATGGATGATGG - Intronic
1073467344 10:103701871-103701893 ATGGATGGATGGATGATAGATGG - Intronic
1073467364 10:103701979-103702001 ATGGATGGATGGATGGTGGATGG - Intronic
1073467376 10:103702031-103702053 ATGGATAGATGGATGATGGATGG - Intronic
1073467381 10:103702057-103702079 ATGGATAGATGGATGGATGATGG - Intronic
1073467399 10:103702161-103702183 ATGGATGGATGGATGGTGGATGG - Intronic
1073679315 10:105685092-105685114 ATCTATTAATGGATGGTATAAGG + Intergenic
1073743807 10:106442473-106442495 ACAATTAAATGGATGGCAGATGG - Intergenic
1073756844 10:106589876-106589898 ATGAAAAAAAGGCTGCTAGAAGG - Intronic
1074587747 10:114784697-114784719 AAAAAAAAATGGATGGTAGCTGG + Intergenic
1074618733 10:115094521-115094543 ATGACTAAATAAATGTTAGAAGG - Intronic
1075578867 10:123601362-123601384 TTAAGTAAATGGATGGCAGAAGG - Intergenic
1076578003 10:131483685-131483707 ATGGATGAATGGATGATGGATGG + Intergenic
1076676720 10:132150900-132150922 ATGGATAAATGGATGGATTAAGG - Intronic
1076844953 10:133065483-133065505 ATGGATGGATGGATGGTGGATGG + Intergenic
1076845004 10:133065654-133065676 ATGGATAGATGGAGGGTGGATGG + Intergenic
1077159570 11:1106513-1106535 ATGGATGGATGGATGGTGGATGG - Intergenic
1077280507 11:1742914-1742936 ATGGATAGATGGATGGAGGATGG + Intronic
1077280512 11:1742937-1742959 ATGGATAGATGGATGGAGGATGG + Intronic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1077480965 11:2814395-2814417 CTGAATAAAAGGATGGTGGGTGG + Intronic
1078143260 11:8706831-8706853 ATGAACAAAAGGAAGGCAGATGG + Intronic
1079317670 11:19422818-19422840 ATGGATCAATGAATGGCAGAAGG - Intronic
1079602893 11:22331433-22331455 ATGGATAAATGAATGGAAGAAGG - Intergenic
1079604622 11:22349439-22349461 ATGAATAGATGGATTGAGGAGGG + Intronic
1079807369 11:24950223-24950245 ATAAATGAATGGATGGATGAAGG + Intronic
1080415115 11:32062562-32062584 ATGGATGGATGGATGGTGGATGG + Intronic
1080743136 11:35083927-35083949 ATGAATAATTGCCTGGAAGAGGG - Intergenic
1080801868 11:35617743-35617765 ATGCATGAATGAATGGGAGATGG + Intergenic
1080849334 11:36054767-36054789 ATGGATAGATGGATGGATGATGG + Intronic
1080849360 11:36054893-36054915 ATGGATGAATGGATGGATGATGG + Intronic
1081287183 11:41285246-41285268 ATGAATGAATGGATGGATGATGG - Intronic
1082696059 11:56366018-56366040 TTAAATAAATGGATGGCATATGG + Intergenic
1083311609 11:61786614-61786636 ATGAGTCAATGGAGGGCAGACGG + Exonic
1083617839 11:64035405-64035427 ATGAATGAATGGATGGCTGGAGG + Intronic
1084365504 11:68694993-68695015 TTGAATTAAGGGAAGGTAGATGG - Intergenic
1084543902 11:69804227-69804249 ATGGATAGATGGATGATGGATGG + Intergenic
1084545957 11:69815199-69815221 ATGGATAGGTGGATGGTGGATGG + Intronic
1084596215 11:70118501-70118523 ATGGATTAATGGATGATAGATGG + Intronic
1084596263 11:70118745-70118767 ATGGACAGATGGATGGTTGATGG + Intronic
1084596493 11:70119799-70119821 GTGAATAGATGGATGCCAGAGGG + Intronic
1084609661 11:70194152-70194174 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609760 11:70194630-70194652 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609812 11:70194913-70194935 ATGTGTGGATGGATGGTAGATGG + Intergenic
1084609837 11:70195037-70195059 ATGGATGGATGGATGGTGGATGG + Intergenic
1084705134 11:70811703-70811725 ATGGATAAATGAATGGTGGATGG - Intronic
1084705154 11:70811817-70811839 ATGGATGAATGAATGGTGGATGG - Intronic
1084781787 11:71414705-71414727 ATGAATGAATGAATGATGGATGG + Intergenic
1084781829 11:71414919-71414941 ATGAATGAATGAATGTTGGATGG + Intergenic
1084785637 11:71440319-71440341 ATGGGTAAATGGATGGATGACGG + Intronic
1085032777 11:73282751-73282773 ATGAATGAATGAATGGAGGAGGG + Intronic
1085406834 11:76268536-76268558 ATGGATGGATGGATGGTGGAGGG - Intergenic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1086087806 11:82972515-82972537 GTGAATAAATGGATGGGTGAAGG + Intergenic
1086263524 11:84970363-84970385 CTGAATGAATGAATGGCAGATGG - Intronic
1086296385 11:85372787-85372809 AGGAATACAAGGATGGAAGAGGG + Intronic
1086401986 11:86468369-86468391 ATGGATAAATGAATGATGGATGG - Intronic
1086791306 11:91041739-91041761 ATGATTAGTTGGATGGTAGAGGG + Intergenic
1088375027 11:109131623-109131645 ATGGATGAATGGATGGTTAAAGG + Intergenic
1088385977 11:109256933-109256955 ATGAATAAAAGGACGAAAGAAGG - Intergenic
1088600119 11:111466615-111466637 ATGGATGGATGGATGATAGATGG + Intergenic
1088960939 11:114663644-114663666 ATAGATAAATAGATGATAGATGG - Intergenic
1089166396 11:116480576-116480598 ATGTATAGATGGATGGATGAAGG + Intergenic
1089271255 11:117303025-117303047 TTGAATGAATGAATGGTTGAAGG + Intronic
1089290380 11:117434228-117434250 ATGGATAATTGGATGGTAGGTGG - Intronic
1089580055 11:119476096-119476118 ATGAATAGATGGATGGTGGGTGG + Intergenic
1089580074 11:119476197-119476219 ATGAATAGATGGATGAATGATGG + Intergenic
1089612926 11:119679647-119679669 CTGAATAAATGGGAGGAAGAGGG - Intronic
1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG + Intronic
1090022390 11:123139523-123139545 ATTCTAAAATGGATGGTAGAAGG + Intronic
1090237171 11:125157951-125157973 GTGAATAAATGAATGGATGAGGG + Intergenic
1090321299 11:125845631-125845653 ATGGATAAATTGATGGAAGTAGG + Intergenic
1090386303 11:126359380-126359402 ATGAAGAAATGGAGGATTGAAGG + Intronic
1090448205 11:126782594-126782616 TTAAGTAAATGGATGGCAGATGG + Intronic
1090511390 11:127379159-127379181 ATAAATAGATAGATGATAGATGG - Intergenic
1090666050 11:128915747-128915769 ATGAGTGATTGGATGGTTGAAGG + Intronic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1090857096 11:130619709-130619731 ATGGATAGATGGATGGAGGATGG - Intergenic
1091011507 11:132005510-132005532 ATGAATGAATGAATGTTGGAAGG + Intronic
1091036642 11:132239983-132240005 ATGAATGGATGGATGGATGATGG - Intronic
1091166751 11:133483830-133483852 ATGGATACATAGATGATAGATGG + Intronic
1091593999 12:1863134-1863156 CTGAATAAATGTATGGGGGAGGG - Intronic
1091709428 12:2727482-2727504 ATGAATGAATGAATGAGAGAAGG + Intergenic
1091791045 12:3272373-3272395 ATGAATAAATGAATGAATGATGG - Intronic
1091876501 12:3938413-3938435 TTAAGTAAATGGATGGTAGGTGG + Intergenic
1092038552 12:5363045-5363067 ATGAATAAATGAAGAGTAAATGG + Intergenic
1092960183 12:13589607-13589629 ATGAATAAATGAAAAGTAGGCGG + Intronic
1092992706 12:13918471-13918493 ATGCATAAATGCATGGTATTTGG - Intronic
1093024176 12:14231823-14231845 AGGGAGGAATGGATGGTAGAAGG - Intergenic
1093856471 12:24110340-24110362 ATTAATGAATGGTAGGTAGATGG - Intergenic
1093965301 12:25318078-25318100 ATAAATAAATGTATGTTAGCTGG - Intergenic
1094326421 12:29244574-29244596 ATGGATAAATGGATGTTTGGAGG - Intronic
1094529062 12:31255747-31255769 AAGAATAAATGGAAGAAAGAGGG - Intergenic
1096481170 12:51942049-51942071 AAGAATAAATAGATGATGGACGG + Intergenic
1096486287 12:51983836-51983858 ATAAATGAAAGGATGCTAGATGG + Intronic
1096611228 12:52803316-52803338 ATGAATAGATGGATGATGGATGG + Intergenic
1096861690 12:54533387-54533409 AGGAAGAAAGGGATGGTTGAAGG - Intronic
1097415253 12:59307262-59307284 ATTGATAAATCGATGGTATATGG + Intergenic
1097532430 12:60821234-60821256 ATGAATGGATGGATGATAGATGG + Intergenic
1097962820 12:65549058-65549080 ATGAATAAATGTATGCATGAAGG + Intergenic
1098399933 12:70064271-70064293 ATGAATAAATGGATTGATGTTGG - Intergenic
1098403591 12:70100010-70100032 ATTAGTAAATGGAGGGTGGATGG - Intergenic
1098940601 12:76530511-76530533 ATGAATAAAAGAATGGGAGGAGG - Intronic
1099004674 12:77222017-77222039 AAGAAAAAATCAATGGTAGAAGG - Intergenic
1100415676 12:94371296-94371318 ATGAATAAACGGAGGGGGGAAGG + Intronic
1100469906 12:94881339-94881361 TTGAATTAATGGATAGTAAAAGG + Intergenic
1100865421 12:98852270-98852292 ATGAATAAATGAATGGCAATGGG + Intronic
1100913463 12:99391077-99391099 ACGAATGAATGGCTGGTACATGG - Intronic
1101076805 12:101138669-101138691 ATGAATAAAACAATAGTAGAAGG + Intergenic
1101099803 12:101380493-101380515 TTGAATGAGTGGAGGGTAGAAGG + Intronic
1101201302 12:102439193-102439215 ATGAATAAATGAATGGAGAAGGG + Intronic
1101311661 12:103586274-103586296 ATGAATAAATAAATAATAGATGG - Intergenic
1101643657 12:106607775-106607797 ATGAATGAATGAATGGTGGGTGG + Intronic
1101801032 12:108022084-108022106 ATGAATGAGTGGATGATGGATGG - Intergenic
1101801096 12:108022524-108022546 ATGAATGAATGGATGATGGAAGG - Intergenic
1101822310 12:108193527-108193549 ATGAATAGATTAATGGTAGGTGG + Intronic
1101873189 12:108582022-108582044 ATGAATGAATGAATGGGGGATGG - Intergenic
1102041329 12:109802807-109802829 ATGGATAGATGGATGGATGAAGG - Intronic
1102043045 12:109812954-109812976 ATGAATGAGTAGATGATAGATGG + Intronic
1102043146 12:109813689-109813711 ATGAATAGATGGATGGATGATGG + Intronic
1102043168 12:109813845-109813867 ATGAATGGATGGATGGATGATGG + Intronic
1102222957 12:111206951-111206973 ATGCATAAATGGATGGTGGTTGG + Intronic
1102222970 12:111207046-111207068 ATGGATAAATGGATGGTGGTTGG + Intronic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1102507192 12:113391005-113391027 ATGAATGAATGGATGGCTGATGG - Exonic
1102514797 12:113439281-113439303 ATGAATTAATGGATTATAGATGG - Intergenic
1102756341 12:115344117-115344139 ATGGATAAATGAATGTAAGAGGG - Intergenic
1103006201 12:117422360-117422382 ATGTATGAATAGATGGTGGATGG - Intronic
1103017775 12:117508943-117508965 ATGAGTGGATGGATGGTAGGTGG + Intronic
1103024063 12:117559068-117559090 ATGGATGGATGGATGGTGGATGG + Intronic
1103064171 12:117883084-117883106 CTGAATGGATGGATGGTTGAAGG - Intronic
1103131019 12:118468732-118468754 ATGAATGAATAGATGGTGGCTGG - Intergenic
1103163183 12:118747979-118748001 ATGGATGGATGGATGGCAGAAGG - Intergenic
1103190327 12:118995798-118995820 ATGAGTAAATGCATGATAAACGG - Intronic
1103211730 12:119172067-119172089 ATCAATAAACGGATTGTAAAAGG - Intergenic
1103255955 12:119541445-119541467 ATGAATGAATGGATGGTGGATGG + Intergenic
1103992527 12:124808637-124808659 ATGAATGGATGGAGGGTGGATGG - Intronic
1104034688 12:125090140-125090162 ATGGATAGATGGATGGATGATGG - Intronic
1104475266 12:129065917-129065939 ATGAATAGATGAATGGTGGGTGG - Intergenic
1104475278 12:129065990-129066012 TTAGATAAATGGATGGTAGATGG - Intergenic
1104778440 12:131404766-131404788 ATGAATGGATGGATGATAAATGG - Intergenic
1104778669 12:131405624-131405646 ATTAATGAATGGATGATAGATGG - Intergenic
1104896288 12:132166577-132166599 ATGAATGAATGTATGATGGATGG - Intergenic
1104896343 12:132166788-132166810 ATGAATGAATGTATGATGGATGG - Intergenic
1104896409 12:132167039-132167061 ATGAATGAATGTATGATGGATGG - Intergenic
1104896447 12:132167179-132167201 ATGAATGAATGTATGATGGATGG - Intergenic
1104926015 12:132314169-132314191 ATGGATAAATGGATGATGGTGGG - Intronic
1105279633 13:18955882-18955904 ATGAACAAATGCATGGAGGATGG - Intergenic
1105786535 13:23755323-23755345 CTGAATAAATGAATGGCTGAAGG + Intronic
1105786537 13:23755363-23755385 CTGAATAAATGAATGGCTGAAGG + Intronic
1106232916 13:27835462-27835484 ATGGATGGATGGATGATAGATGG + Intergenic
1106722920 13:32454688-32454710 ATAAATAGATGGAAGTTAGAAGG + Intronic
1106909660 13:34450077-34450099 ATCAATAAATGTATGATAGATGG + Intergenic
1107742461 13:43465856-43465878 ATAAATGAATGGATGGTAGGTGG - Intronic
1107836957 13:44420070-44420092 ATGAATGAATGAATGGAAAAGGG - Intergenic
1108161220 13:47641903-47641925 ATAAATAAAAGGATAGAAGAAGG + Intergenic
1108499430 13:51056095-51056117 ATGAATAAATGAATGAGAGGTGG - Intergenic
1109255603 13:60077097-60077119 ATGAATAAATGAATGATACTTGG + Intronic
1109554261 13:63950784-63950806 TTAAGTAAATGGATGGTAGCTGG + Intergenic
1109638369 13:65153227-65153249 ATAAATAAAAGGATGGAAAAAGG - Intergenic
1110752517 13:79131803-79131825 TTGAATGAATGGATGGATGAAGG - Intergenic
1111163714 13:84429279-84429301 TTAAATAAATGGATGGAAGATGG - Intergenic
1112188791 13:97154772-97154794 CTGAATAAATAAATGGTATAAGG + Intergenic
1112218207 13:97458414-97458436 GTGAATAAATGAAGGGAAGAAGG + Intronic
1112260472 13:97873560-97873582 AGAAAGAAATGGATGGCAGATGG + Intergenic
1112410594 13:99160060-99160082 AGGAGTAAATTGATGCTAGAAGG + Intergenic
1112659310 13:101489290-101489312 ATGGATAAACACATGGTAGATGG + Intronic
1112727064 13:102317019-102317041 ATGAATTAATGAATGGAAAATGG - Intronic
1112943471 13:104895061-104895083 TTATATAAATGGATGGCAGATGG - Intergenic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113072945 13:106439003-106439025 ATGGATATATGGATGGATGAAGG + Intergenic
1113417572 13:110140288-110140310 ATGGATGGATGGATGGTGGATGG + Intergenic
1113507379 13:110826545-110826567 ATGATTCAATTGATGGTGGATGG + Intergenic
1114347422 14:21810903-21810925 ATGAATAAATGAATGGTCTTTGG - Intergenic
1114916121 14:27267413-27267435 ATGGAGAAATGGATGACAGATGG + Intergenic
1115068127 14:29290574-29290596 TTAAATAAATGGGTGGTGGAAGG + Intergenic
1115390319 14:32847117-32847139 AAGAATGAATGACTGGTAGATGG + Intergenic
1116268397 14:42727190-42727212 ATGGATGGATGGATGGAAGATGG - Intergenic
1116553476 14:46272435-46272457 ATGAAGAAAGGGAAGGGAGACGG + Intergenic
1117382922 14:55183446-55183468 ATTATTAACTGGTTGGTAGAAGG - Intronic
1118210036 14:63757294-63757316 AGGAATACATGGATTGAAGAAGG + Intergenic
1120375611 14:83702976-83702998 GTAAGTAAATGAATGGTAGATGG + Intergenic
1120662660 14:87269238-87269260 ATAAAGAAATGGAAGGTGGATGG + Intergenic
1121005019 14:90484562-90484584 ATGGATAGATGGATGGCAGATGG - Intergenic
1121423186 14:93830050-93830072 ATGGATGGATGGATGGTGGATGG + Intergenic
1121550845 14:94798804-94798826 ATAAATAAATGTATGCCAGAGGG + Intergenic
1121627177 14:95394421-95394443 ATGAGTGAATGGAGGGTTGAAGG + Intergenic
1121627191 14:95394520-95394542 TTGAATATATGGATGGATGATGG + Intergenic
1121746006 14:96293508-96293530 ATGAATAAATGTTTGGAGGAAGG + Intronic
1122109083 14:99482431-99482453 ATGAAAGAATGGATGGATGATGG + Intronic
1122426810 14:101614427-101614449 TTAAGTAAATGGATGGTGGATGG + Intergenic
1122600686 14:102920190-102920212 GTGAATGAATGAGTGGTAGATGG - Intergenic
1122600791 14:102920718-102920740 GTGGATAAGTGGATGGTGGATGG - Intergenic
1122600813 14:102920828-102920850 GTGAATAGGTGGATGGTGGATGG - Intergenic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1122794185 14:104197612-104197634 ATGGATGAATGGATAATAGATGG - Intergenic
1122813205 14:104299117-104299139 ATGGATGGATGGATGGAAGATGG - Intergenic
1124139912 15:27068069-27068091 ATGGCTCAATGGATGGCAGAGGG + Intronic
1124199860 15:27669874-27669896 TTGAGTAAATGGATGACAGAGGG + Intergenic
1124398557 15:29328687-29328709 TTAAGTAAATGGATGGCAGATGG + Intronic
1124452229 15:29805523-29805545 ATGAATGAATGAATGATACATGG - Intronic
1124858996 15:33419496-33419518 AAAAATAAATGAATGATAGATGG - Intronic
1125101094 15:35913629-35913651 CTGAATGAATAAATGGTAGATGG - Intergenic
1125431837 15:39603211-39603233 ATGAATGAATGGATGGCAGATGG + Intronic
1125529112 15:40400072-40400094 ATAAATAAATGGGAGGGAGAAGG - Intergenic
1126226827 15:46280468-46280490 ATAAATTCATGGATGGTGGATGG + Intergenic
1126759613 15:51957431-51957453 ATGAGTAGATGGGTGGTGGAGGG + Intronic
1127032947 15:54884098-54884120 ATAAATTAAGGGACGGTAGAGGG + Intergenic
1127172316 15:56315877-56315899 ATGAATAAAATGAAGCTAGAAGG - Intronic
1127694090 15:61427306-61427328 AAAAATAAATGAATGGAAGAAGG + Intergenic
1128265213 15:66260121-66260143 ATGAATGAATGGATGATGGGTGG + Intergenic
1128442703 15:67727492-67727514 AAGTATAAATGGAGGGTAGTAGG - Intronic
1128455940 15:67831483-67831505 ATGCAAGAATGGAAGGTAGAAGG - Intronic
1128518924 15:68362576-68362598 ATGGATAAGTGGGTGGTAGATGG + Intronic
1128518934 15:68362660-68362682 ATGGATAAATGGATGGAAGATGG + Intronic
1128518954 15:68362821-68362843 ATGAATTAGTGGATGGATGATGG + Intronic
1129587699 15:76885468-76885490 ATGAATGAATGAATGTTATATGG - Intronic
1129604991 15:77020525-77020547 GTGACTAAATGGATGGAGGATGG - Intronic
1130353625 15:83111358-83111380 GTGAATAGATGGATGGATGATGG - Intronic
1130353634 15:83111400-83111422 ATGAATGGATGGATGGATGATGG - Intronic
1130353648 15:83111488-83111510 ATGGATAGATGGATGGATGATGG - Intronic
1130376954 15:83337826-83337848 ATGAATAAATGAATAGATGAAGG + Intergenic
1130671551 15:85917394-85917416 ATGAATAAATGAATGAGACATGG + Intergenic
1130733831 15:86527928-86527950 ATGGATGAATGGATGATGGATGG - Intronic
1132019070 15:98344857-98344879 ATGAATGGATGGATGGTGGATGG + Intergenic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1132030881 15:98437847-98437869 ATGGATGGATGGATGGAAGATGG + Exonic
1132054495 15:98639079-98639101 ATGAGTAAATGGATGGCAGATGG + Intergenic
1132083649 15:98888262-98888284 ATGAATAAATGAAGAATAGATGG + Intronic
1132653755 16:1033021-1033043 ATGAGTGGATGGATGATAGATGG - Intergenic
1132653776 16:1033142-1033164 ATGGATTGATGGATGGTGGATGG - Intergenic
1132772281 16:1570474-1570496 CTGAGCAAATGGAGGGTAGATGG - Intronic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1133563021 16:6967212-6967234 ATAAACAAATGGATGATGGATGG - Intronic
1133611046 16:7433687-7433709 ATGGACAGAAGGATGGTAGAAGG - Intronic
1133965929 16:10531777-10531799 ATGAATGAATGAATGGTGGATGG + Exonic
1134075107 16:11285266-11285288 ATGAATAAGTGAATGGCAAATGG + Intronic
1134263179 16:12670343-12670365 ATAAATAAATAAATGGTAGGGGG + Intronic
1134488468 16:14677903-14677925 AAGAATGAATGGATGGATGATGG + Intronic
1134488469 16:14677907-14677929 ATGAATGGATGGATGATGGATGG + Intronic
1134632237 16:15765161-15765183 ATGAATAAATGGATAGAGGATGG + Intronic
1134668621 16:16038129-16038151 ATGTATACATGGTAGGTAGATGG + Intronic
1135086494 16:19478794-19478816 ATGGGTAAATGGATGGATGATGG - Intronic
1135538601 16:23313141-23313163 ATGAATAAATGAATGAATGATGG + Intronic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135806610 16:25548385-25548407 ATGAATATCATGATGGTAGATGG - Intergenic
1135898503 16:26432832-26432854 ATGAATGAATGAATGGAAGGAGG + Intergenic
1136059695 16:27718107-27718129 ATGAATTAATGCATGAAAGATGG + Intronic
1136071332 16:27789281-27789303 ATGGATGGATGGATGGTTGATGG + Exonic
1136071345 16:27789349-27789371 ATGGATGGATGGATGGTTGATGG + Exonic
1136071455 16:27790099-27790121 ATGAATGAATGAATGATGGATGG + Exonic
1136392122 16:29972334-29972356 ATGACTAAATGGAAGACAGAAGG - Intronic
1137368635 16:47883658-47883680 AGGAAGGAATGGATGGTAGAGGG - Intergenic
1137386142 16:48044181-48044203 ATGAATGGATGGATGGATGATGG - Intergenic
1137386189 16:48044481-48044503 ATGGATGGATGGATGGTAAATGG - Intergenic
1137528427 16:49259665-49259687 TTAAGTAAATGAATGGTAGATGG + Intergenic
1137561654 16:49506303-49506325 ATGGGGGAATGGATGGTAGACGG + Intronic
1137569431 16:49555682-49555704 ATGGACAGGTGGATGGTAGATGG + Intronic
1137748823 16:50842978-50843000 ATGAATAAATGAATGAATGAAGG + Intergenic
1137765029 16:50971481-50971503 ATGGATGGATGGATGATAGATGG - Intergenic
1138495703 16:57407958-57407980 ATAGATGGATGGATGGTAGATGG - Intronic
1138845166 16:60556135-60556157 ATAAATAACAGGATGGTATAGGG - Intergenic
1139450269 16:67023823-67023845 ATGAATAAATGGATGCTGTGGGG + Intergenic
1139560598 16:67739265-67739287 ATGAAGTAATGGATGGAAAAGGG - Intronic
1139982663 16:70872525-70872547 ATGGATGAATGGATGATGGATGG - Intronic
1140017606 16:71203149-71203171 ATGCATAGATGGATGGAAGGAGG + Intronic
1140917140 16:79504595-79504617 ATGGATAAATGGATAGAGGATGG + Intergenic
1140951728 16:79824971-79824993 ATGAATGCATGGATGGTAGATGG - Intergenic
1141031880 16:80596315-80596337 ATGGATAAAAGGATGATGGATGG + Intergenic
1141110045 16:81265045-81265067 ATGGATGGATGGATGGTAGATGG - Intronic
1141110129 16:81265418-81265440 ATGAATGGATGGATGGTGGATGG - Intronic
1141110182 16:81265620-81265642 ATGAATGGATGGATGGTGGATGG - Intronic
1141110239 16:81265875-81265897 GTGGATGGATGGATGGTAGATGG - Intronic
1141163669 16:81646067-81646089 ATGGAAGTATGGATGGTAGATGG + Intronic
1141314315 16:82946248-82946270 ATGGATAAATGGATGTGGGAGGG + Intronic
1141391324 16:83667074-83667096 ATGGATAGATGGATGATGGATGG + Intronic
1141421565 16:83921153-83921175 ACGAATAGATGGAAGGAAGATGG + Exonic
1141421616 16:83921379-83921401 ATGGATAGATGGATGGAGGAGGG + Exonic
1141619874 16:85231476-85231498 ATGAATAGATGGATGGACGGAGG + Intergenic
1141619882 16:85231565-85231587 ATGAATGAGTAGATGATAGATGG + Intergenic
1141657973 16:85426207-85426229 ATGGATGGATGGATGGTAGATGG + Intergenic
1141658009 16:85426366-85426388 GTGGATGAATGGATGATAGATGG + Intergenic
1141658094 16:85426714-85426736 ATGGATGGATGGATGGTAGATGG + Intergenic
1141659381 16:85433739-85433761 ATGGATCAATGGATGCTGGATGG + Intergenic
1141854932 16:86674278-86674300 ATGAACAAATGAATGGTGGGAGG - Intergenic
1141899339 16:86980379-86980401 ATGGATAAATAGATGATAGAGGG + Intergenic
1142124131 16:88401794-88401816 GTGGATGGATGGATGGTAGATGG + Intergenic
1142124194 16:88402064-88402086 ATGGATGGATAGATGGTAGATGG + Intergenic
1142152397 16:88518440-88518462 ATGGATAGATGGATGGTGGGTGG + Intronic
1142152629 16:88519433-88519455 ATGGATAGATGCATGGTGGATGG + Intronic
1142244761 16:88964981-88965003 ATGGATAAATAGATGGTGGGTGG - Intronic
1142960542 17:3549781-3549803 ATGAGTGAATGGATGATGGATGG + Intronic
1142960544 17:3549808-3549830 ATGAATAAATGATTGATGGATGG + Intronic
1143071395 17:4297276-4297298 ATGAATAAATGGATAGATGGAGG - Intronic
1143073277 17:4316497-4316519 ATTAATTAATGGAAGGTTGAAGG - Intronic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143301490 17:5913855-5913877 ATGGATGGATGGATGGAAGATGG - Intronic
1143408261 17:6692309-6692331 ATGAATAGATGCATGGATGATGG + Intronic
1143553890 17:7649026-7649048 ATGAATGAATGAATGGGAGTTGG - Intronic
1143737741 17:8925104-8925126 ATGGATAGATAGATAGTAGATGG + Intronic
1143737747 17:8925223-8925245 ATGGATAGATAGATAGTAGATGG + Intronic
1143766321 17:9139903-9139925 ATGGATGAATGGATGGATGATGG - Intronic
1143863847 17:9909907-9909929 ATGAATAGATGGATGGGACCGGG + Intergenic
1144482846 17:15641754-15641776 ATGAATGGATGGATGGATGATGG + Intronic
1144915840 17:18723277-18723299 ATGAATGGATGGATGGATGATGG - Intronic
1145261027 17:21354972-21354994 ATGAATGAATGAATGGAAGTTGG + Intergenic
1145262410 17:21362340-21362362 ATGAATGGATGGATGGATGATGG + Intergenic
1145926572 17:28651889-28651911 TTCAATACATGGATGGCAGATGG + Intronic
1145978964 17:29000501-29000523 ATGAATGAATGAATGATGGATGG + Intronic
1146506409 17:33409582-33409604 ATGAATTAATTGGTGGTGGAGGG - Intronic
1146805545 17:35862332-35862354 CTGAATAAATGGATGAATGATGG + Intronic
1146826726 17:36029582-36029604 ATGGATGGATGGATGGGAGATGG - Intergenic
1146939192 17:36832292-36832314 ATGGACAGATGGATGGTGGATGG - Intergenic
1147977502 17:44256179-44256201 ATGAATAGATGGATAATGGATGG - Intronic
1148085487 17:44991290-44991312 ATGGACAGATGGATGGGAGATGG + Intergenic
1148235987 17:45969479-45969501 ATGTATAATTGGATGGATGATGG - Intronic
1148692681 17:49540649-49540671 TTCAGTAAATGGATGGTTGATGG - Intergenic
1148803835 17:50253358-50253380 ATGGAGAAATGGCTGGTTGACGG + Intergenic
1149252766 17:54789079-54789101 ATGAACAGATGGATGAAAGAAGG + Intergenic
1149854975 17:60074590-60074612 AGGAAGAAATGGATGCTAGTAGG - Intronic
1150392281 17:64796911-64796933 ATAGATAGATGGATGGTGGATGG - Intergenic
1150439039 17:65176937-65176959 ATGGATGAATGGGTGGTAGGTGG - Intronic
1150634543 17:66903803-66903825 GTGGATAGATGGATGGTGGAGGG + Intergenic
1150924788 17:69521671-69521693 ATGAATAAATGGATGAATGGGGG - Intronic
1151428790 17:74048788-74048810 ATGAATGAATGAAAGGAAGAAGG + Intergenic
1152034039 17:77861096-77861118 ATGAATAAATGGGTGAAAGGTGG + Intergenic
1152034054 17:77861163-77861185 ATGGATGAATGGATGGAGGATGG + Intergenic
1152301818 17:79499276-79499298 ATGAATAAATGGATGGTAGATGG - Intronic
1152301845 17:79499465-79499487 ATGAATGAATGGATGGTGGATGG - Intronic
1152314102 17:79570155-79570177 GATAATAGATGGATGGTAGATGG + Intergenic
1152453086 17:80395956-80395978 ATGAATAAAGGGTTGGGAGGGGG - Exonic
1152473737 17:80504196-80504218 ATGAATATATGGGTGGATGAAGG + Intergenic
1152766974 17:82147090-82147112 ATGGATATATGGATGGTAGGTGG + Intronic
1152767267 17:82148250-82148272 ATGGATGGATGGATGGTAGATGG + Intronic
1152767482 17:82148995-82149017 ATGAATGGATGGGTGGTGGATGG + Intronic
1203173072 17_GL000205v2_random:169457-169479 AGGAATATATGGAGGGCAGAAGG + Intergenic
1153103624 18:1502381-1502403 ATGAATGAATGAATGATACAAGG - Intergenic
1153127386 18:1810982-1811004 TTGAGTAAATGGATGCTATATGG - Intergenic
1153274980 18:3359601-3359623 ATGAATAGATGATAGGTAGATGG + Intergenic
1153857012 18:9159737-9159759 ATTAATAAATGGATGGTGAAGGG - Intronic
1155871685 18:31037551-31037573 ATGAATGAATGAATGTTACAAGG - Intronic
1156879332 18:42057954-42057976 CTGAATAAAGAAATGGTAGAAGG + Exonic
1156946067 18:42833111-42833133 ATGAATAAATGTATGTTAATAGG - Intronic
1157004457 18:43565299-43565321 ATGAATAAATGTATAGTTGATGG + Intergenic
1157395281 18:47336039-47336061 ATGAACCAATGGATGGTCCATGG - Intergenic
1157468957 18:47973135-47973157 AAGAATAAGTAGATGGGAGAAGG + Intergenic
1157525778 18:48380333-48380355 TTAAATAAATGGATGGCAGATGG + Intronic
1158677436 18:59533717-59533739 GTGAATTAATGCATGGTACAGGG - Intronic
1158803229 18:60938053-60938075 TTGAAAAAATGGATGGCAGAAGG - Intergenic
1159133292 18:64306222-64306244 GTGAATAAATAGATGGAAGGGGG + Intergenic
1159249366 18:65853861-65853883 ATGAATAAATGGAAGACATAAGG + Intronic
1159609842 18:70513139-70513161 ATGAAGCAGTGGATGGGAGATGG + Intergenic
1160297415 18:77650693-77650715 ATGGATAAATGGGTGATAAATGG - Intergenic
1160328845 18:77974096-77974118 ACCAAAAAATGGATGGTGGATGG + Intergenic
1160502560 18:79409521-79409543 ATGAATGGATGGATGATGGATGG - Intronic
1160526659 18:79542553-79542575 ATGAATGAATGGATGGATGGTGG - Intergenic
1161105282 19:2440782-2440804 ATGAGTAGATGGATGGATGATGG - Intronic
1161242749 19:3231613-3231635 ATAGATGGATGGATGGTAGATGG + Intronic
1161242807 19:3231874-3231896 ATGAATAGATGGATGGATGATGG + Intronic
1161242828 19:3231988-3232010 ATGAATGGATGGATGGATGATGG + Intronic
1161433846 19:4250276-4250298 ATGAATAAATGAATGAATGAGGG - Intronic
1161449218 19:4335247-4335269 ATGAATGCATGGATGGATGATGG - Intronic
1161499011 19:4603035-4603057 ATGGATATATGGATTATAGATGG + Intergenic
1161499018 19:4603094-4603116 ATGGATATATGGATTATAGATGG + Intergenic
1161499069 19:4603322-4603344 ATGGATATATGGATTATAGATGG + Intergenic
1161499081 19:4603393-4603415 ATGGATATATGGATTATAGATGG + Intergenic
1161633118 19:5369339-5369361 ATGAATAGATGGATGATGGATGG - Intergenic
1161633148 19:5369477-5369499 ATGAATAAATGGGTGACGGATGG - Intergenic
1161768977 19:6221247-6221269 ATGAATGAATGGATGGATGAGGG - Intronic
1162180842 19:8867693-8867715 ATGGATGGATGGATGGTGGATGG + Intronic
1162424739 19:10587629-10587651 ATCAATGAATCGATGGAAGATGG - Intergenic
1163095034 19:15051049-15051071 ATTAATGGATAGATGGTAGATGG + Intronic
1163095041 19:15051120-15051142 ATAGATGAATGGATGGTTGATGG + Intronic
1163232611 19:16014773-16014795 AGGAATAACTGGCGGGTAGAGGG - Intergenic
1163347690 19:16754245-16754267 ATGGATAGATGGATGGAAGATGG - Intronic
1163382631 19:16978931-16978953 ATGGATAAATGGATGGATGGTGG - Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163609980 19:18295650-18295672 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609990 19:18295695-18295717 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609997 19:18295729-18295751 ATGGATGGATGGATGGTGGATGG - Intergenic
1163894173 19:20042721-20042743 ATTAATAAAGGGATGGGAAATGG - Intergenic
1164597775 19:29541457-29541479 ATGAATAGATGGGTGGATGATGG + Intronic
1164670297 19:30068536-30068558 ATGGATAGATGGATGATGGATGG - Intergenic
1164678931 19:30121247-30121269 ATGGAGAAATGGATGGGGGATGG - Intergenic
1164706510 19:30324033-30324055 ATGGATAGATGGATGGAGGATGG - Intronic
1164719687 19:30423267-30423289 ATGAATAGATGGGTGGTAGATGG - Intronic
1165098346 19:33422693-33422715 ATGGGTAGATGGATGGTAGATGG - Intronic
1165190325 19:34057497-34057519 ATGGATAAATGGATGATGGATGG + Intergenic
1165322456 19:35094387-35094409 ATGAGTGGATGGATGATAGATGG - Intergenic
1165501306 19:36191704-36191726 ATGAACAAGTGAATGGAAGAGGG + Intronic
1165759164 19:38310463-38310485 ATGGATGGATGGATGATAGATGG - Intronic
1165867574 19:38948446-38948468 ATGAATAAATAAATGGGGGAAGG + Intronic
1166771798 19:45287770-45287792 ATGAATGAATGGGTAGAAGAAGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1166929716 19:46294985-46295007 ATAAATAAATAAATAGTAGAAGG - Intergenic
1166935600 19:46330604-46330626 ATGGATGCATGGATGGTGGATGG + Intronic
1166935606 19:46330627-46330649 ATGGATGGATGGATGGTGGATGG + Intronic
1166935621 19:46330707-46330729 ATGGATGGATGGATGGTGGATGG + Intronic
1166935641 19:46330792-46330814 ATGGATGGATGGATGGTGGATGG + Intronic
1167169752 19:47823248-47823270 ATGAATGAATGAAGGGCAGAAGG + Intronic
1167387634 19:49173390-49173412 ATGGGTAAATGGATGGAAGATGG - Intronic
1167556107 19:50196787-50196809 ATAAATAAATGGATGAATGAGGG - Intronic
1167639274 19:50671692-50671714 ATGAATGAATGGATGGAATCGGG + Intronic
1168330930 19:55568082-55568104 ATGCATAGATGGATGGATGATGG + Intergenic
1168330961 19:55568266-55568288 ATGAATAGATGGATGGATTATGG + Intergenic
1168330965 19:55568293-55568315 ATGTATAGATGGATGGCTGATGG + Intergenic
1168635882 19:57996510-57996532 ATAAATAAATGGCTGGTAAGGGG + Intronic
925119342 2:1405291-1405313 ATGAGTGAATGGATGATGGATGG - Intronic
925489250 2:4373838-4373860 ATGGATAAATGGATGGAATAAGG - Intergenic
925520773 2:4742418-4742440 TTCAGTAAATGGATGGCAGATGG + Intergenic
925614029 2:5728457-5728479 ATCAATGAATGGATGATGGATGG + Intergenic
925697102 2:6592096-6592118 ATAGATAAATGGATGGATGATGG - Intergenic
925925605 2:8667993-8668015 ATGAATGGATGGATGGATGAAGG + Intergenic
925925649 2:8668234-8668256 ATAAATGAATGGATGGATGAAGG + Intergenic
925938130 2:8787764-8787786 AGGAATAAAGGAAAGGTAGAGGG - Intronic
926214018 2:10892604-10892626 ATGGATGGATGGATGGAAGAAGG - Intergenic
927088497 2:19692942-19692964 TTGAGTAAATGGATGGCAGATGG - Intergenic
927447626 2:23178429-23178451 ATGAATAAATATCTAGTAGATGG - Intergenic
927645216 2:24873075-24873097 AGGAATGAATGGGTGGCAGAGGG - Intronic
928077236 2:28276181-28276203 AAGAATAAAGAGATGGTAAAAGG + Intronic
928234049 2:29524761-29524783 ATGGATCAATGGATGATAGATGG + Intronic
928234060 2:29524824-29524846 ATGAATGGATGGATGGTAGATGG + Intronic
929254332 2:39792951-39792973 ATTAATATAAGTATGGTAGAAGG + Intergenic
929646295 2:43632049-43632071 ATGAATGAATGAATGATTGATGG - Intergenic
930247879 2:49003605-49003627 ATGAACAAATAGATGGAAGCAGG + Intronic
930255697 2:49087680-49087702 ATGCATAGTTGGGTGGTAGATGG + Intronic
930267702 2:49219259-49219281 ATGGATGGATGGATGGTAGGCGG - Intergenic
930416840 2:51099543-51099565 ATAACTAAATGGATGGCAGGTGG - Intergenic
930669278 2:54131351-54131373 ATCAATGAATAGATGGTGGAAGG + Intronic
930903131 2:56532534-56532556 ATGAAAAAATGGATCCTAGTTGG - Intergenic
931006279 2:57853315-57853337 TTAAGTAAATGGATGGCAGATGG - Intergenic
931169179 2:59784511-59784533 ATGAATGGATGGATGGTGAATGG + Intergenic
931169181 2:59784538-59784560 ATGAATAGATGGATGATGAATGG + Intergenic
931219429 2:60276030-60276052 ATGAATAAATAAATGGCACAGGG - Intergenic
931322602 2:61185768-61185790 CTGAATAATTGGAGGGGAGATGG + Intronic
931367726 2:61633900-61633922 AGGAATAGAGGGATGGCAGATGG - Intergenic
931593182 2:63909313-63909335 ATGAATAAATGAATGGTGGTTGG + Intronic
931916320 2:66960732-66960754 ATGCACAAAGGGGTGGTAGATGG - Intergenic
932912449 2:75819607-75819629 ATGAATGAATAGATGATGGATGG - Intergenic
933285137 2:80377248-80377270 ATGGATAAATGGAAGACAGATGG - Intronic
933296812 2:80500360-80500382 ATGAATGGATGGATAATAGATGG - Intronic
933563806 2:83924185-83924207 ATGAATGAATGGAGGGATGATGG - Intergenic
933803800 2:85983538-85983560 GTGAATGAATGGATGACAGAGGG + Intergenic
933968216 2:87447991-87448013 CTGGATGGATGGATGGTAGATGG + Intergenic
934175154 2:89572330-89572352 ATGAATGAATGAATGAAAGAAGG + Intergenic
934285470 2:91646684-91646706 ATGAATGAATGAATGAAAGAAGG + Intergenic
934613895 2:95759599-95759621 ATGAATGAATGGATGGATGGAGG + Intergenic
934613919 2:95759781-95759803 ATGAATGGATGGATGGCAGATGG + Intergenic
934613923 2:95759800-95759822 ATGGATGGATGGATGGCAGATGG + Intergenic
934613928 2:95759819-95759841 ATGGATGGGTGGATGGTAGATGG + Intergenic
934613958 2:95760055-95760077 ATGAGTAGATGGATGCTAGATGG + Intergenic
934613974 2:95760158-95760180 AAGAATGGATGGATGGTAGATGG + Intergenic
934646954 2:96064395-96064417 ATGAATGGATGGATGGTAGATGG - Intergenic
934646988 2:96064630-96064652 ATGAATGGATGGATGGTAGATGG - Intergenic
934647005 2:96064745-96064767 ATGAATGAATGGATGGTAGATGG - Intergenic
934647022 2:96064860-96064882 ATGGATGGATGGATGGTAGATGG - Intergenic
934647026 2:96064879-96064901 ATGGATGGATGGATGGTAGATGG - Intergenic
934840380 2:97620621-97620643 ATGAATGAATGGATGGTAGATGG - Intergenic
934840395 2:97620724-97620746 ATGGATGGATGGATGGTAGATGG - Intergenic
935637136 2:105257998-105258020 ATGAATGAATGAATGGAAAATGG + Intergenic
935782255 2:106518670-106518692 AGGAATGAATGGATGGTGAATGG - Intergenic
936325581 2:111502513-111502535 CTGGATGGATGGATGGTAGATGG - Intergenic
936853276 2:116927681-116927703 ATAAGTAAATGGATTGTCGAAGG + Intergenic
937027459 2:118711316-118711338 AGGAATAAATGGATGCCAGAGGG - Intergenic
937107831 2:119334977-119334999 TTAAATAAATGGATAGCAGATGG + Intronic
937173313 2:119899949-119899971 CTGATTAAATGAATGGTAGGTGG + Intronic
937317764 2:120942857-120942879 ATGAATGAATGAATGAAAGAGGG - Intronic
937970743 2:127546885-127546907 GTGGATAGATGGATGGTGGATGG - Intronic
938231295 2:129662184-129662206 CTGAGTAAATGGATGGCAGGTGG + Intergenic
938787960 2:134650082-134650104 GTGAAAAAATGGAAGGTATAGGG + Intronic
939113747 2:138037743-138037765 ATGAATGAATGAATGAGAGAGGG + Intergenic
939679296 2:145110468-145110490 ATGAATAAATAGATGATGAATGG + Intergenic
939942735 2:148369955-148369977 ATGAGTAAATGTATGGTAGGTGG - Intronic
940927643 2:159383618-159383640 AGAGATAAATGGGTGGTAGAAGG - Exonic
941750662 2:169132087-169132109 ATGAATAGATGGATGATGAATGG + Intronic
942218021 2:173741608-173741630 ATGAATAAATGAATGGTTTGAGG - Intergenic
942341152 2:174949339-174949361 ATGAATAAATGAATGAGACAGGG + Intronic
942501954 2:176600628-176600650 ATGAATAAGTGAATTGTAGCTGG + Intergenic
943088665 2:183348147-183348169 ATGAATGAATGAATGTTACAAGG - Intergenic
943191448 2:184683642-184683664 ATGAATACAGGCAAGGTAGAGGG + Intronic
943540902 2:189212715-189212737 AAGAAAAATTGAATGGTAGATGG + Intergenic
943582330 2:189699523-189699545 ATGAGTAAATGAATGATAGGTGG - Intronic
944285750 2:197948112-197948134 ATGAGAAACAGGATGGTAGATGG + Intronic
945159532 2:206874981-206875003 ATGAATAGATGGATGAATGATGG - Intergenic
945541705 2:211095878-211095900 ATGAAGAAATGGCTGGTTGACGG - Intergenic
945729026 2:213509507-213509529 ATGAGTAAATAGAGGTTAGATGG - Intronic
946367913 2:219261653-219261675 AGGAATAACGGGATGGTAGTAGG - Intronic
946414822 2:219534758-219534780 ATGGATGGATGGATGGCAGATGG - Intronic
947964381 2:234267219-234267241 ATGAAGAGATGGATGGGAGGTGG - Intergenic
948458503 2:238118255-238118277 ATGGAGGAATGGATGGTGGAGGG + Intronic
948539718 2:238681394-238681416 ATGAAGCAAGGGATGGCAGAAGG - Intergenic
948815640 2:240509046-240509068 ATGGATGAGTGGAGGGTAGATGG + Intronic
948818784 2:240527824-240527846 ATGGATGAATGGATGGTAGGTGG + Intronic
949065739 2:241989524-241989546 ATGGATGAATGGATGGTGGGTGG - Intergenic
949065752 2:241989576-241989598 ATGGATGGATGGATGGTGGATGG - Intergenic
949065765 2:241989631-241989653 ATGGATGGATGGATGGTGGATGG - Intergenic
949065798 2:241989774-241989796 ATGGATGAATGGATGGTGGATGG - Intergenic
949065806 2:241989811-241989833 ATGGATGGATGGATGGTGGATGG - Intergenic
949065816 2:241989849-241989871 ATGGATGAATGGATGGTGGGTGG - Intergenic
949065828 2:241989902-241989924 ATGGATGCATGGATGGTGGATGG - Intergenic
949065879 2:241990122-241990144 ATGGATGCATGGATGGTGGATGG - Intergenic
949065883 2:241990141-241990163 ATGGATGCATGGATGGTGGATGG - Intergenic
949065894 2:241990186-241990208 ATGGATGCATGGATGGTGGATGG - Intergenic
949065898 2:241990205-241990227 ATGGATGCATGGATGGTGGATGG - Intergenic
949065906 2:241990238-241990260 ATGGATGCATGGATGGTGGATGG - Intergenic
949065920 2:241990289-241990311 ATGGATGGATGGATGGTGGATGG - Intergenic
949065938 2:241990354-241990376 ATGGATGGATGGATGGTGGATGG - Intergenic
949065948 2:241990392-241990414 GTGGATAGATGGATGGTGGATGG - Intergenic
949065955 2:241990422-241990444 ATGGATGGATGGATGGTGGATGG - Intergenic
949065977 2:241990504-241990526 ATGGATGGATGGATGGTGGATGG - Intergenic
949065986 2:241990537-241990559 ATGGATGGATGGATGGTGGATGG - Intergenic
949065992 2:241990560-241990582 ATGGATGGATGGATGGTGGATGG - Intergenic
1168756639 20:323102-323124 ATGCATGCATGGATGGAAGAAGG + Intergenic
1168950790 20:1800321-1800343 TTAAGTAAATGGATGGCAGATGG + Intergenic
1169567740 20:6874052-6874074 ATGAATAAATAAATGATTGAGGG + Intergenic
1170073964 20:12398692-12398714 GTATATAAATGGATGATAGATGG + Intergenic
1170154321 20:13255874-13255896 ATGAATGAATGGCTGGTTGGTGG - Intronic
1170348609 20:15415766-15415788 ATGGATATATGGATGATGGATGG - Intronic
1170361177 20:15548084-15548106 ATGGATGAATGGATGGAGGAAGG - Intronic
1170563420 20:17578286-17578308 ATGAATGAGTGAATGGGAGAGGG + Intronic
1170956595 20:20985636-20985658 ATGAATGAATGAATGGTGAATGG - Intergenic
1171154447 20:22859415-22859437 ATTTAGAAATGGATGGTATATGG - Intergenic
1171330559 20:24333985-24334007 ATGAGTAAACTGATGGCAGAAGG + Intergenic
1172230773 20:33334154-33334176 ATGGGTAGATGGATGGTGGATGG + Intergenic
1172576569 20:36013715-36013737 TTCAGTAAATGGATGGCAGAGGG + Intronic
1172832865 20:37851061-37851083 ATGAGTAAGTGGCTGGAAGAGGG + Intronic
1172939116 20:38642633-38642655 AAGAATAAATGGAAGGGAGGTGG - Intronic
1172939121 20:38642656-38642678 GAGAATAAATGGGTGGTGGAAGG - Intronic
1173116214 20:40245644-40245666 ATGAAGAAATGAAATGTAGATGG - Intergenic
1173350483 20:42240735-42240757 ATGGATAAATGGATGATGGGTGG - Intronic
1173460372 20:43238514-43238536 AGGAATAAACGGGTGGGAGAAGG + Intergenic
1173754914 20:45507502-45507524 TTTAAAAAATGGATGATAGATGG + Intergenic
1173871498 20:46344890-46344912 ATGGATGAATGGATGGTAGATGG - Intergenic
1173976600 20:47191490-47191512 ATGGATTAGTGGATGGTGGATGG + Intergenic
1174239501 20:49121964-49121986 AAGATGAAATGGCTGGTAGATGG - Intronic
1174366618 20:50060501-50060523 ATGAATGAATGAATGAGAGAAGG + Intergenic
1174577288 20:51545573-51545595 ATGGATGCATGGATGGAAGATGG + Intronic
1174577307 20:51545662-51545684 ATGGATGCATGGATGGAAGATGG + Intronic
1174894215 20:54431282-54431304 ATCACTAATGGGATGGTAGAAGG - Intergenic
1174940004 20:54916434-54916456 ATTAATGAATGAATGGTGGATGG - Intergenic
1174966228 20:55219249-55219271 ACAAGTAAATAGATGGTAGATGG - Intergenic
1175138018 20:56839607-56839629 ATGGATGAATGGATGGTAAGTGG + Intergenic
1175141898 20:56867000-56867022 CTCAATAAATGGCTGATAGACGG + Intergenic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175277279 20:57780829-57780851 ATGGATAGATGGATGATAGGTGG - Intergenic
1175301919 20:57948960-57948982 ATGGATGAATGGATGATGGATGG + Intergenic
1175301982 20:57949292-57949314 ATGGATGAATGGATGATGGATGG + Intergenic
1175302009 20:57949432-57949454 ATGGATGGATGGATGGCAGATGG + Intergenic
1175369255 20:58476139-58476161 ATGAATGAATGAATGATAGTTGG - Intronic
1175493239 20:59393381-59393403 ATGATTAGATGGATGACAGATGG - Intergenic
1175649456 20:60705792-60705814 TTGAGTAAACGGATGGTGGATGG - Intergenic
1175659532 20:60800478-60800500 ATAAGTAAATGGATAGTGGATGG + Intergenic
1175687995 20:61045296-61045318 ATGGATGGATGGATGGTGGATGG - Intergenic
1175754158 20:61518807-61518829 ATGGATTAATGGATGGATGATGG - Intronic
1175754183 20:61518980-61519002 ATGGATGAATGGATGGATGAAGG - Intronic
1175772631 20:61633182-61633204 ATGGATGAATGGATGGAGGATGG - Intronic
1175779244 20:61671862-61671884 ATGGATGGATGGATGGTGGATGG + Intronic
1175781064 20:61682358-61682380 ATGGATGGATGGATGGTGGATGG + Intronic
1175798981 20:61790219-61790241 ATGAATGGATGGATGGTAGGTGG - Intronic
1175799056 20:61790661-61790683 ATGAATGGATGGATGGTGGGTGG - Intronic
1175799084 20:61790824-61790846 ATGAATGGATGGATGGTGGGTGG - Intronic
1175799097 20:61790887-61790909 ATCAATGGATGGATGGTAGGTGG - Intronic
1175817282 20:61889859-61889881 ATGGATAGATGGATGGTGGATGG + Intronic
1175817344 20:61890199-61890221 ATGGATAGATGGATGTTGGATGG + Intronic
1175817364 20:61890310-61890332 ATGGATAGATGGATGATGGATGG + Intronic
1175817391 20:61890448-61890470 ATGGATAAATGGATGATGGAAGG + Intronic
1175817960 20:61893389-61893411 GTGAATAGAGGGATGGTGGATGG + Intronic
1175817979 20:61893472-61893494 ATGAGTAGAGGGATGGTGGATGG + Intronic
1175818038 20:61893710-61893732 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818052 20:61893761-61893783 GTGAATAGAGGGATGGTGGATGG + Intronic
1176047147 20:63098679-63098701 ATGAATTGATGGATGGATGATGG + Intergenic
1176047150 20:63098702-63098724 ATGGATAAATGAATGGATGATGG + Intergenic
1176329055 21:5531099-5531121 AGGAATATATGGAGGGCAGAAGG + Intergenic
1176398702 21:6289852-6289874 AGGAATATATGGAGGGCAGAAGG - Intergenic
1176438455 21:6699252-6699274 AGGAATATATGGAGGGCAGAAGG + Intergenic
1176462717 21:7026322-7026344 AGGAATATATGGAGGGCAGAAGG + Intergenic
1176486278 21:7408100-7408122 AGGAATATATGGAGGGCAGAAGG + Intergenic
1177799804 21:25817389-25817411 AAGAGTAAATGGCTGGTAGATGG + Intergenic
1178175108 21:30087807-30087829 ATGAATAAATCAATGAAAGAAGG + Intergenic
1178264575 21:31131075-31131097 ATGAATGAATGGAAGGTGGGTGG - Intronic
1178280856 21:31281637-31281659 ATAAATAGGTGGATGGTAGATGG + Intronic
1178280895 21:31281864-31281886 GTGGATAGATGGATGGTAGATGG + Intronic
1178755995 21:35350238-35350260 ATGATTAAATGGATTTCAGAGGG + Intronic
1178788779 21:35678658-35678680 ATGAATGAATGGATGCAAGGAGG + Intronic
1178926462 21:36779375-36779397 ATGGATGGATGGGTGGTAGATGG - Intronic
1179125936 21:38590644-38590666 ATGAATACATGGATGATGGATGG - Intronic
1179402207 21:41094698-41094720 AAGAATACATGGATGAGAGATGG + Intergenic
1179474384 21:41633982-41634004 ATGAATGAATGGGTGGTAGATGG - Intergenic
1179474764 21:41636106-41636128 ATGAATGGATGGATGATGGATGG - Intergenic
1179549121 21:42132178-42132200 ATGGATGGATGGATGATAGATGG - Intronic
1179549167 21:42132507-42132529 ATGAATGAAGGGATGACAGAAGG - Intronic
1179549176 21:42132561-42132583 ATGAACAGATGGATGGATGATGG - Intronic
1179899548 21:44382043-44382065 ATGGATGAATGGTTGGTAGGTGG + Intronic
1181002419 22:19994121-19994143 ATGAATGAATGGAGGGTGGCTGG + Intronic
1181002442 22:19994218-19994240 ATGAATGGATGGATGGGGGATGG + Intronic
1181482135 22:23206922-23206944 AGGAATGAATGGATGACAGAGGG - Intronic
1181537129 22:23552219-23552241 ATGAATAAGAGGATGGATGACGG - Intergenic
1181824873 22:25507028-25507050 ATGAATAAAAGGATGGGGGATGG - Intergenic
1181824894 22:25507149-25507171 ATGAATAAAAGGATGGAGGATGG - Intergenic
1181958982 22:26609478-26609500 ATGGATAAAGGGATGGATGAAGG + Intronic
1182042190 22:27246870-27246892 ATGAATTGGTGGATGATAGATGG + Intergenic
1182048531 22:27295904-27295926 ATGGATAAATGGACAGTGGATGG + Intergenic
1182086638 22:27565500-27565522 ATGGATAGATGGATGGATGATGG + Intergenic
1182970521 22:34570434-34570456 TTAAGTAAATGGATGGTGGATGG - Intergenic
1182995791 22:34810830-34810852 TTTAATAAATGGGTGGTAAATGG + Intergenic
1183100062 22:35578439-35578461 ATGGATGGATGGATGGTGGATGG + Intergenic
1183106449 22:35618515-35618537 ATGAATTAAGGGATGACAGATGG - Intronic
1183303944 22:37072028-37072050 ATGAATGGATGGATGGTGGATGG + Intronic
1183303975 22:37072197-37072219 ATGAATGGATGGATGGATGATGG + Intronic
1183303999 22:37072322-37072344 ATGGATGAATGGATGGATGATGG + Intronic
1183304000 22:37072326-37072348 ATGAATGGATGGATGATGGATGG + Intronic
1183304035 22:37072523-37072545 ATGGATGAATGGATGGATGATGG + Intronic
1183304038 22:37072542-37072564 ATGGATGAATGGATGGATGATGG + Intronic
1183304039 22:37072546-37072568 ATGAATGGATGGATGATGGATGG + Intronic
1183304081 22:37072753-37072775 ATGGATAGATGGATGATGGATGG + Intronic
1183304123 22:37072984-37073006 ATGGATAGATGGATGATGGATGG + Intronic
1184285714 22:43470185-43470207 ATGGATAGATGGATGGTTTATGG - Intronic
1184293046 22:43508502-43508524 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293053 22:43508525-43508547 ATGGATGGATGGATGGGAGATGG - Intergenic
1184293214 22:43509056-43509078 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293321 22:43509408-43509430 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293388 22:43509661-43509683 ATGGATGGATGGATGATAGATGG - Intergenic
1184321301 22:43744104-43744126 ATGAATGAATGGATGGGTTATGG + Intronic
1184410416 22:44323022-44323044 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410476 22:44323254-44323276 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410502 22:44323362-44323384 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410518 22:44323437-44323459 ATGGATGGATGGATGGTTGATGG - Intergenic
1184410529 22:44323500-44323522 ATGGATGGATGGATGGTTGATGG - Intergenic
1184414668 22:44345394-44345416 ATGAGTGAACAGATGGTAGATGG + Intergenic
1184460829 22:44636927-44636949 ATGGATAGATGGATGATGGATGG + Intergenic
1184460851 22:44637034-44637056 ATGGATAGATGGATGATGGATGG + Intergenic
1184460874 22:44637133-44637155 ATGGATAGATGGATGATGGATGG + Intergenic
1184880738 22:47302849-47302871 ATGGATGAATAGAAGGTAGACGG - Intergenic
1184942726 22:47780947-47780969 ATTAATTAATGGATGGTTGGAGG + Intergenic
1184991045 22:48170278-48170300 ATGAATGAATGGATGGAAAGAGG - Intergenic
1184996764 22:48212878-48212900 ATGAATAAATGATGGCTAGATGG - Intergenic
1185005498 22:48274179-48274201 ATGAATGGATGGATGGATGAAGG - Intergenic
1185018830 22:48361524-48361546 ATGGATAGATGGATGATAGATGG + Intergenic
1185018832 22:48361551-48361573 AAGAGTGAATGGATGATAGATGG + Intergenic
1185018853 22:48361712-48361734 ATGGATAGATGGATGATGGATGG + Intergenic
1185076745 22:48687265-48687287 GTGGATGAATGGATGGTGGACGG + Intronic
1185104358 22:48858911-48858933 ATGGATGAATGGATGATGGAGGG - Intergenic
1185104449 22:48859291-48859313 ATGAATGGATGGATGGATGATGG - Intergenic
1185108523 22:48887690-48887712 ATGAATGGATGGATGGTGGATGG - Intergenic
1185136073 22:49073391-49073413 ATGAATGAATGAATGTGAGAAGG + Intergenic
1185165588 22:49260426-49260448 ATGAATGGATGGATGATGGATGG - Intergenic
1185165589 22:49260430-49260452 ATGGATGAATGGATGGATGATGG - Intergenic
1185165597 22:49260477-49260499 ATGGATGAATGGATGATGGATGG - Intergenic
1185193493 22:49453436-49453458 ATGAGTGAATGGATGATGGATGG + Intronic
1185196791 22:49476767-49476789 ATGGATGAATGGATGCTGGATGG + Intronic
1185196810 22:49476847-49476869 ATGGATGGATGGATGGTGGATGG + Intronic
1185196821 22:49476893-49476915 ATGGATGGATGGATGGTGGATGG + Intronic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
1185196851 22:49477040-49477062 ATGAATAGATGGATGGTAAATGG + Intronic
1185196871 22:49477125-49477147 ATGGATGGATGGATGGTGGATGG + Intronic
1185196886 22:49477190-49477212 ATGGATGGATGGATGGTGGATGG + Intronic
1185196932 22:49477385-49477407 ATGGATGGATGGATGGTGGATGG + Intronic
1185196952 22:49477460-49477482 ATGGATGGATGGATGGTGGATGG + Intronic
1185196988 22:49477593-49477615 ATGGATGGATGGATGGTGGATGG + Intronic
1185197001 22:49477649-49477671 ATGGATGGATGGATGGTGGATGG + Intronic
1185197036 22:49477771-49477793 ATGGATGGATGGATGGTGGATGG + Intronic
1185197042 22:49477794-49477816 ATGGATGGATGGATGGTGGATGG + Intronic
1185197048 22:49477817-49477839 ATGGATGGATGGATGGTGGATGG + Intronic
1185215532 22:49597976-49597998 ATGAATAAATGGAGGACAGAAGG - Intronic
949286036 3:2405676-2405698 ATTAATAAATGAATTATAGAAGG + Intronic
949845357 3:8364686-8364708 ATGAATGAATGGATGGATGAAGG - Intergenic
949866129 3:8548988-8549010 ATGAATAAATGCATGAATGAGGG - Intronic
950081405 3:10224776-10224798 ATGGATGGATGGGTGGTAGATGG - Intronic
950321882 3:12063484-12063506 TTAAGTAAATGGATGGAAGATGG + Intronic
950657651 3:14446987-14447009 ATGGATAGATGGATGGAAAATGG - Intronic
950739096 3:15035292-15035314 ATGAATGAATGAATGTTAGGAGG + Intronic
950871181 3:16230878-16230900 ATTAATACAGGAATGGTAGAGGG - Intronic
950995120 3:17487472-17487494 ATGAAAAATTAGATGTTAGAAGG + Intronic
951477822 3:23127051-23127073 AAGAATAAATGGATGTTAGAAGG - Intergenic
951779149 3:26343484-26343506 ATGCATAAATAGAGGGTAAAAGG - Intergenic
952280704 3:31920582-31920604 TTAAGTAGATGGATGGTAGATGG + Intronic
952790239 3:37194586-37194608 ATGAATAATTTTATGGCAGATGG - Intergenic
953019757 3:39106094-39106116 ATGAAAAAATACATGGTAGGTGG - Intronic
954240074 3:49286770-49286792 ATGGATAGATGGATGGATGATGG - Intronic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
955100719 3:55846998-55847020 ATGAAGAAATGATTGGCAGATGG + Intronic
955590784 3:60533091-60533113 GTGAATGAATTGATGGCAGATGG - Intronic
956069754 3:65435488-65435510 ATGGATGGATGGATGGAAGATGG + Intronic
956642374 3:71427276-71427298 ATGAATAAATGGATACAAAACGG + Intronic
956885928 3:73559730-73559752 ATAAAAACATGGATAGTAGAAGG + Intronic
957321968 3:78642929-78642951 TTGAATAAATGAATGTCAGAAGG - Intronic
957379990 3:79415137-79415159 TTGAATGAATGAATGGCAGAAGG - Intronic
957447417 3:80331957-80331979 TTAAGTAAATGGATGGCAGATGG + Intergenic
957609066 3:82443937-82443959 ATAAATAAATAGATGTTAAAGGG + Intergenic
958158009 3:89780035-89780057 ATGATTAAATGAATAGTATAAGG + Intergenic
958440644 3:94152220-94152242 ATGAACAAATGGTTGTTATAGGG + Intergenic
958473062 3:94546559-94546581 ATAAAGAAATGTATGGTAGAAGG - Intergenic
958560245 3:95739938-95739960 ATGACTAAATGTAATGTAGATGG - Intergenic
958884879 3:99714613-99714635 ATGGATAAATGGATGGAAACAGG - Intronic
959129462 3:102335799-102335821 ATGAATGAATAGATGTTATAAGG - Intronic
959655241 3:108796820-108796842 ATCAAGTAATGGATGGTAAAAGG + Intergenic
959758457 3:109927858-109927880 ATGATTAAATGAATGGAAGATGG + Intergenic
960368870 3:116809564-116809586 ATGAATAAATAGGTGGTAGTGGG + Intronic
962106931 3:132399969-132399991 GTGAAGAAATGGGTGGCAGAAGG - Intergenic
962557332 3:136567462-136567484 ATGAGTAAAAGGAAGTTAGAAGG - Intronic
962718791 3:138152791-138152813 ATGAATAAATGAGTGGTCTAGGG + Intergenic
962804076 3:138914887-138914909 ATGGATGAATGGATGGATGAAGG + Intergenic
963059815 3:141216309-141216331 ATGAATGAATGAATGGATGATGG + Intergenic
963402547 3:144819253-144819275 ATAAATAAAAGGATTGGAGATGG - Intergenic
964430480 3:156600599-156600621 AGGAAAAAATTGATGGTAGGTGG + Intergenic
965134631 3:164746623-164746645 ATGAATGAATGCATAGTTGAAGG + Intergenic
965138935 3:164810746-164810768 AAGTTTAAATGGATTGTAGATGG - Intergenic
965162652 3:165154376-165154398 CTAAGTAAATGGATGGTGGATGG + Intergenic
965356563 3:167681487-167681509 ATGAATGAATGGATGGATCAGGG + Intergenic
965437636 3:168672065-168672087 AGGAAGAAATGGAAGGAAGAAGG - Intergenic
965690024 3:171345946-171345968 ATGGATGGATGGATGGTAGATGG + Intronic
967298742 3:187991269-187991291 ATGGATTAGAGGATGGTAGACGG - Intergenic
967300478 3:188007741-188007763 ATAAATAAATGAATGGAATAAGG - Intergenic
967453814 3:189657603-189657625 TTAAACAAATGGATGGTACATGG + Intronic
967566351 3:190978282-190978304 CTGAATAAATGGATAGTTGTGGG + Intergenic
967610144 3:191495576-191495598 TTAAATAAATGGATGACAGATGG - Intergenic
967767218 3:193294148-193294170 GTGAATAAATGGAAGACAGATGG + Intronic
967787188 3:193510000-193510022 ATGCATGAATGGAGGGGAGAAGG + Intronic
968266385 3:197366637-197366659 ATGAATACAAGGTTGGAAGAGGG + Intergenic
968594604 4:1475937-1475959 ATGAATAGATGGGTGGATGATGG + Intergenic
968761895 4:2446782-2446804 ATTATCAGATGGATGGTAGATGG + Intronic
968761954 4:2447096-2447118 ATGGATGGATGGATGATAGATGG + Intronic
968914509 4:3491536-3491558 ATGAATGAATAGGTGGGAGAAGG - Intronic
969206213 4:5648372-5648394 ATGAATTAATGAATGATGGATGG - Intronic
969206531 4:5651409-5651431 ATGAGTAAATGGATGATGGATGG + Intronic
969424819 4:7118049-7118071 ATGGATAGATGGATGGTGGGTGG + Intergenic
969424852 4:7118201-7118223 ATGGAGAGATGGATGGGAGATGG + Intergenic
969424879 4:7118333-7118355 ATGGATAAATGCATGGATGATGG + Intergenic
969424915 4:7118515-7118537 ATGGATAAATGCATGGATGATGG + Intergenic
969424958 4:7118718-7118740 ATGGATAAATGCATGGATGATGG + Intergenic
969465126 4:7351799-7351821 ATGGATGAATGGATGGGTGATGG - Intronic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
969510492 4:7614811-7614833 ATGGATGAATGGATGGTGGTTGG - Intronic
969510551 4:7615130-7615152 ATGAGTGAATGGATGGCAGATGG - Intronic
969510728 4:7616338-7616360 ATGAATAGGTGGATGGTGGATGG - Intronic
969510751 4:7616446-7616468 ATGGATGAATGAATGGTAGATGG - Intronic
969510863 4:7617151-7617173 TTGGATAGATGGATGGTGGATGG - Intronic
969514943 4:7641945-7641967 ATGAATGGATGGATGGTAGATGG + Intronic
969528492 4:7716520-7716542 ATGAATAGATGGATGGTGGATGG - Intronic
969528516 4:7716653-7716675 ATGAATAGATAGATGGTGGATGG - Intronic
969612265 4:8234017-8234039 ATGAATGGATGGATGGATGATGG - Intronic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
969612290 4:8234175-8234197 ATGAATGGATGGATGATGGATGG - Intronic
969612291 4:8234179-8234201 ATGGATGAATGGATGGATGATGG - Intronic
969624393 4:8294959-8294981 ATGGGTAAATGGATGGATGATGG - Intronic
969674077 4:8605377-8605399 ATGAATGAATGGGTGGATGATGG - Intronic
969687536 4:8684030-8684052 TTGAATAGATAGATGCTAGATGG + Intergenic
970064300 4:12074355-12074377 ATGAATAGAGGGATGGTGTAAGG - Intergenic
970479572 4:16459377-16459399 ATGGACAGGTGGATGGTAGACGG - Intergenic
971105340 4:23518128-23518150 ATGAATTAATGGTTGGTAGGTGG - Intergenic
971143786 4:23953374-23953396 TTGAATAAATGTCTAGTAGAAGG + Intergenic
971152850 4:24052251-24052273 ATGAATAAATGAATGAGTGAAGG + Intergenic
971425011 4:26507485-26507507 GTGAATGGATGGATGGAAGAAGG + Intergenic
971425022 4:26507532-26507554 ATGGATAAATCAATGGAAGAGGG + Intergenic
971811726 4:31436551-31436573 ATAATTAAATGGATGGAAAATGG + Intergenic
971819632 4:31534553-31534575 ATCAGTAAATGGATGGTAAATGG - Intergenic
972084279 4:35194230-35194252 ATACACAAATGGATGGCAGATGG - Intergenic
972599782 4:40561899-40561921 ATGAATAAATGAATGAGAGAAGG - Intronic
972956598 4:44399955-44399977 ATGAATTAAAGAATGGTAGAGGG - Intronic
973088288 4:46097363-46097385 AGAAAAAAATGGATGGTAGAAGG + Intronic
973298265 4:48551267-48551289 ATGTATAAATAGGTGGTATATGG - Intronic
973698393 4:53513338-53513360 ATGAAGATATGGACAGTAGAAGG + Intronic
973902364 4:55489033-55489055 ATGGATAAATGGATAGTGTAAGG - Intronic
973981456 4:56311580-56311602 ATAAATAAATGAAAGCTAGAAGG + Intronic
974370249 4:61007376-61007398 ATGTATAAGTGAGTGGTAGAGGG - Intergenic
974388519 4:61233985-61234007 ATGAAAAAATTGATGGGAAAGGG + Intronic
975031331 4:69621535-69621557 AGCTATAAATGGTTGGTAGAAGG + Intronic
975617169 4:76257933-76257955 ATGAATAAATGAATGATCGGTGG + Intronic
976130256 4:81876665-81876687 ATGAATTAAATGTTGGTAGAAGG - Intronic
976855948 4:89605702-89605724 CTGAAAAAAAGGATAGTAGATGG + Intergenic
977164167 4:93674913-93674935 ATAAGTAAATGGATGGAAGAGGG + Intronic
978326704 4:107565856-107565878 ATGAATCAATAGATCATAGAAGG + Intergenic
978343940 4:107746255-107746277 TTAATTAAATGGATGGCAGATGG + Intergenic
978980265 4:114936446-114936468 ATAGATAAATAGATGATAGATGG + Intronic
978991890 4:115093886-115093908 AACAATAAAAAGATGGTAGAAGG + Intronic
979323797 4:119355159-119355181 GTGAATAAATGCATGGAAAATGG - Intergenic
979633156 4:122925891-122925913 ATGAATAAATGAAGGGTGGATGG + Intronic
979698842 4:123644089-123644111 GTGAATGAATGGATGGGTGATGG - Intergenic
979847794 4:125538363-125538385 ATAAATAAATGAATAGAAGAGGG + Intergenic
980171356 4:129293990-129294012 ATGAATATATGGAGTGTGGAAGG + Intergenic
980308566 4:131098520-131098542 ATGAATGAATGAGTGGTAAACGG - Intergenic
981204241 4:142019904-142019926 ATGAATAAATGAATTATACAGGG + Intergenic
981819848 4:148873577-148873599 ATCAAAAAATGGATAGTACATGG + Intergenic
981841662 4:149120096-149120118 TACAATAAATGGAAGGTAGAGGG + Intergenic
983394975 4:167182362-167182384 ATGAATAAAAGGATTCTAGAAGG + Intronic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
983649120 4:170020952-170020974 ATTAATGAATGGATGGAATATGG + Intronic
983770266 4:171540167-171540189 ATGGATAGATGGATGGTGGAAGG - Intergenic
983911523 4:173244801-173244823 ATGATTAATTGGATGTCAGAAGG + Intronic
984388754 4:179100057-179100079 ATAAATAAAAGAATGGGAGAAGG + Intergenic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
984992153 4:185391495-185391517 ATAAATAAATAAATGGGAGATGG - Intronic
985045256 4:185934227-185934249 ATGAATAAATGAATGAAAGCAGG - Intronic
985703799 5:1389139-1389161 ATGAATGAATGGGTGGGTGAAGG - Intergenic
985829693 5:2219323-2219345 ATGGATGGATGGATGGTAGATGG - Intergenic
986072879 5:4304430-4304452 ATGAATAGATGGATGATGGATGG - Intergenic
986277827 5:6295639-6295661 TTAAATAAATGGATGGTGAATGG + Intergenic
986279271 5:6310185-6310207 ATGAATGAATGAATGAAAGACGG - Intergenic
987018361 5:13844220-13844242 ATGAAGAAATGGATGTTACTAGG + Intronic
987067999 5:14308515-14308537 ATGGATAAATGGATGGAGGTTGG - Intronic
987274211 5:16344906-16344928 ATGAATAAATGAAAATTAGATGG - Intergenic
987948575 5:24647857-24647879 ATGAATAAATGAAATGTAAAAGG + Intergenic
988060245 5:26158334-26158356 ACAAGTAAATGGATGGTGGATGG - Intergenic
988417525 5:30964239-30964261 ATGAATGAAAGGGTGGTAGTGGG + Intergenic
990521686 5:56587465-56587487 ATGAATGAATGGATGGGATAGGG - Intronic
990761875 5:59138712-59138734 ATGACTGAATGGATGATACAGGG - Intronic
990960295 5:61386925-61386947 ATAAATGAGTGGTTGGTAGAGGG - Intronic
991957226 5:72007234-72007256 ATGAATGAATGGCTGAAAGATGG + Intergenic
992194151 5:74323382-74323404 AAGAACAAATGGATGAAAGAAGG + Intergenic
992294415 5:75313425-75313447 ATAAATAAATAGTTTGTAGAGGG - Intergenic
992885088 5:81150565-81150587 AAGAATAAATGGATGATGGGGGG - Intronic
993096416 5:83484318-83484340 ATGAATAGATAGATGATGGATGG - Intronic
993215485 5:85017781-85017803 ATGAATATATGAATGGTACCTGG + Intergenic
994963234 5:106631661-106631683 AACAATAAATGGATCATAGAGGG - Intergenic
995347206 5:111134506-111134528 ATGAATAAATCAATGATTGAAGG - Intergenic
995614339 5:113944180-113944202 AAGAATAAATGCATTGAAGAAGG + Intergenic
996340221 5:122429722-122429744 ATATATAAAAGGATGGTTGAGGG + Intronic
996904417 5:128581805-128581827 AATAATAGATGGATGGCAGATGG + Intronic
997748068 5:136317301-136317323 ATGAATGAGTGAATGGCAGATGG - Intronic
998297105 5:140981681-140981703 ATGAATGAATGAATGATGGAAGG - Intronic
998480278 5:142457550-142457572 ATGAATAAATTAATGGGGGATGG - Intergenic
998515573 5:142750737-142750759 ATGAATGAATGAATGATGGAAGG + Intergenic
999513636 5:152278600-152278622 ATGAATAAATGGAGGCATGAAGG - Intergenic
999650746 5:153765055-153765077 ATGAATAAGAGGATAGTATATGG + Intronic
999746741 5:154598182-154598204 ATGGATGAATGGATGGATGATGG + Intergenic
1000165092 5:158640531-158640553 ATTAATAACTGGATGGTAGGAGG + Intergenic
1000620280 5:163477106-163477128 ATAAATAAGTGTATGGGAGAAGG - Intronic
1000937762 5:167323280-167323302 ATGGCTAAATGGATAGTAGGCGG + Intronic
1001147556 5:169198033-169198055 ATGCATAGATGGATGGTGGTTGG - Intronic
1001211543 5:169814472-169814494 ACGAGAAAATGGATGTTAGAAGG + Intronic
1001422550 5:171598812-171598834 GTGGATAGGTGGATGGTAGATGG + Intergenic
1001646256 5:173284368-173284390 ACGAATAGATGGATGGTGGATGG - Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1001751428 5:174134481-174134503 ATGAATTGATGAATGGAAGATGG - Intronic
1001865678 5:175103026-175103048 ATGGATAGATGGATGATGGATGG + Intergenic
1001870223 5:175147896-175147918 TTAAATAAATAGATGGCAGATGG + Intergenic
1002033807 5:176449619-176449641 ATGGACATATGGATGTTAGAAGG + Intronic
1002067664 5:176660209-176660231 ATGAGTGAATGGATGGAGGAAGG - Intergenic
1003287745 6:4749399-4749421 ATGAATGAATGTATGATGGATGG + Intronic
1003520586 6:6855434-6855456 TTGAATGAATGGATGGAAAATGG - Intergenic
1003972550 6:11313138-11313160 ATGAATAGATGGATGGTTGGTGG + Intronic
1003972566 6:11313236-11313258 ATGAATAGATAGATGGTGGGTGG + Intronic
1003972588 6:11313354-11313376 CTGAGTAGATGGATGGTGGATGG + Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004997771 6:21210788-21210810 ATGTATGAAAGGATGCTAGATGG + Intronic
1005190760 6:23220454-23220476 AAGAATAGATGAATAGTAGATGG - Intergenic
1005707707 6:28471782-28471804 CTAAATAAATGAATGCTAGATGG - Intergenic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1005842283 6:29751580-29751602 ATAAATAAATAAATAGTAGATGG - Intergenic
1006370225 6:33639734-33639756 ATGAATAGATGGATGATTGGGGG + Intronic
1006558800 6:34891025-34891047 CTAAATAAATGGATGGTGGATGG + Intronic
1006937127 6:37726265-37726287 GAGAGTAAATGGATGGTATATGG - Intergenic
1007148308 6:39660201-39660223 ATGAAGAAATAGATGCTTGAGGG - Intronic
1007575441 6:42922760-42922782 AAGAATACATGGAGGATAGATGG + Intronic
1007769514 6:44181306-44181328 CTCAAGAAATGGATGGTAAAGGG + Exonic
1007922430 6:45622610-45622632 ATGTAAATGTGGATGGTAGACGG - Intronic
1008404084 6:51099647-51099669 AAGAATAAATGTATGCTGGAGGG + Intergenic
1008422134 6:51313636-51313658 ATGAATGGATGGATGATGGATGG - Intergenic
1008422135 6:51313640-51313662 ATGGATGAATGGATGGATGATGG - Intergenic
1009747090 6:67830965-67830987 ATAAATAAGTGGATGGTTGAAGG + Intergenic
1010688672 6:78881808-78881830 ATAAATAAGTGGATAGTGGATGG + Intronic
1011023446 6:82839848-82839870 ATATGTAAATGGATGGCAGATGG + Intergenic
1011140769 6:84153585-84153607 AGTAATAAATTGATGTTAGAAGG - Intronic
1011149446 6:84253946-84253968 ATGAATAAACGGATGGGTGTTGG + Intergenic
1011505382 6:88036240-88036262 ATCAATAAAAGAATGATAGATGG - Intergenic
1011582117 6:88880204-88880226 ATGAATGAATGAAAGGAAGAAGG + Intronic
1011907978 6:92396364-92396386 GTAAGTAAATGGATGGAAGATGG - Intergenic
1012397079 6:98810934-98810956 ATGGATGAATGGATGGCTGATGG + Intergenic
1012645563 6:101675177-101675199 AAAAATAAATGGAGGGTAGAGGG - Intronic
1013657800 6:112263663-112263685 TTGAATGAATGGATGGTGAATGG - Intergenic
1014200024 6:118598861-118598883 ACAAGTAAATGGATGGTAGATGG + Intronic
1015141544 6:129939856-129939878 ATGAATGAATGGATGGATGATGG - Intergenic
1015144997 6:129975916-129975938 AGGAAGAAAGGGATGGAAGAAGG - Intergenic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1015553313 6:134434886-134434908 ATAAATGAGTGGATGGTGGATGG + Intergenic
1015993308 6:138971173-138971195 AAGAATTAATGGCTGGTGGAAGG - Intronic
1016352807 6:143185772-143185794 ATGCATGAATGAATGGTTGAGGG + Intronic
1016522057 6:144956720-144956742 ATGGATAGATAGATGATAGATGG - Intergenic
1016522060 6:144956804-144956826 ATGGATAGATAGATGATAGATGG - Intergenic
1016522064 6:144956910-144956932 ATGGATAGATAGATGATAGATGG - Intergenic
1016522065 6:144956929-144956951 ATGGATAGATAGATGATAGATGG - Intergenic
1016774669 6:147892159-147892181 ATGAATAAAAGGATGAAAGAAGG - Intergenic
1017385019 6:153873363-153873385 ATGGAGAAATGGCTGGTAGGTGG + Intergenic
1017659036 6:156656056-156656078 ATGAATGAATGGATGGATGAGGG - Intergenic
1018133288 6:160752811-160752833 ATGTATATATGGATAGTAGAAGG + Intronic
1018333647 6:162760944-162760966 GTGAATAAATTCAGGGTAGATGG + Intronic
1018413150 6:163576328-163576350 ATGAATTAATTCATAGTAGAAGG + Exonic
1018853166 6:167655635-167655657 ATGGATGAATGGATGGATGATGG + Intergenic
1019003924 6:168780365-168780387 ATGAATAAATGGATGAGTGAAGG + Intergenic
1019103323 6:169649712-169649734 ATGAGTGAATGGATGGGTGATGG - Intronic
1019326849 7:442703-442725 ATGGATGGATGGATGGTAGATGG + Intergenic
1019326889 7:442901-442923 ATGAATAGATGGATGGATGGTGG + Intergenic
1019326903 7:442969-442991 ATGAATAGATGGATGGATGGTGG + Intergenic
1019326922 7:443064-443086 ATGAATAGATGGATGGATGGTGG + Intergenic
1019327023 7:443520-443542 ATGGATGGATGGATGGTGGATGG + Intergenic
1019327066 7:443727-443749 GTGAATAGATGGATGGTGGATGG + Intergenic
1019345529 7:528229-528251 ATGAATAGATAGATGATTGATGG + Intergenic
1019555833 7:1630894-1630916 ATAAATGGATGGATGGTGGATGG - Intergenic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1019914649 7:4124975-4124997 ATGTATGGATGGATGATAGATGG + Intronic
1019914699 7:4125219-4125241 ATGGATAGATGGATGATGGATGG + Intronic
1019914705 7:4125246-4125268 ATGAATGGATGGATGGGTGATGG + Intronic
1019914725 7:4125361-4125383 ATGGATGAATGGATGGGTGATGG + Intronic
1019914734 7:4125396-4125418 ATGGATAGATGGATGGATGATGG + Intronic
1020365839 7:7379665-7379687 ATGAATAAATGAATGGAGAAAGG + Intronic
1021016586 7:15543100-15543122 ACTAATAAATAGATGGCAGATGG - Intronic
1021423775 7:20474990-20475012 GCTAATAAATGGGTGGTAGATGG + Intergenic
1021509118 7:21416194-21416216 ATCAATAAATGGATGTTGGCAGG - Intergenic
1022350157 7:29560726-29560748 AAAAAAAAGTGGATGGTAGAGGG - Intergenic
1022908979 7:34882095-34882117 ATGAATGGATGGATGGATGATGG + Intergenic
1023116446 7:36867196-36867218 ATGGATAGATGGATGATGGATGG - Intronic
1024025383 7:45405756-45405778 TTAAGTCAATGGATGGTAGATGG + Intergenic
1024407741 7:49001965-49001987 ATGACCAGCTGGATGGTAGAGGG - Intergenic
1024694506 7:51840986-51841008 ATGAATAGATGAAAGATAGACGG + Intergenic
1025120103 7:56294618-56294640 ATGAATGGATGGATGGTTGATGG + Intergenic
1025120123 7:56294731-56294753 ATGAATGGATGGATAGTGGATGG + Intergenic
1025120134 7:56294787-56294809 ATGAATGGATGAATGGTGGATGG + Intergenic
1025245018 7:57310356-57310378 ATGGATGAATGGATGAGAGATGG - Intergenic
1025606884 7:63045842-63045864 ATGGATGAATGGATGATGGATGG - Intergenic
1026080160 7:67210857-67210879 ATGGATAGATAGATGATAGAAGG - Intronic
1026203537 7:68235736-68235758 ATGGATGAATGGATGGAAGGTGG + Intergenic
1026203538 7:68235740-68235762 ATGAATGGATGGAAGGTGGATGG + Intergenic
1026203561 7:68235896-68235918 ATGAATGAATGGATGGATGAAGG + Intergenic
1026203569 7:68235926-68235948 ATGAATGGATGCATGGTGGATGG + Intergenic
1026275173 7:68870131-68870153 ATGGATAGATGGTAGGTAGACGG + Intergenic
1026275189 7:68870221-68870243 ATGGATAGATGGATGATGGATGG + Intergenic
1026275213 7:68870372-68870394 ATGAATGGATGGATGATGGATGG + Intergenic
1026275217 7:68870399-68870421 ATGGATCAATGGATGATGGATGG + Intergenic
1027372058 7:77516750-77516772 GTCAGTAAATAGATGGTAGATGG - Intergenic
1027502999 7:78978923-78978945 CTGAATAAATGAATGGTGGATGG + Intronic
1027951287 7:84820498-84820520 TTAAATACATGGATGGCAGATGG + Intergenic
1028278847 7:88895266-88895288 ATAAGTAAATGGGTGGCAGATGG + Intronic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1029599759 7:101556818-101556840 ATGGATGGATGGATGATAGATGG + Intronic
1029604820 7:101592212-101592234 ATGAGTGGATGGATGGTGGATGG - Intergenic
1030167338 7:106568571-106568593 AAAAATAAATGGATGGTGGGGGG + Intergenic
1030668550 7:112308888-112308910 ATGAAGAAATGGATAGTTGTGGG + Intronic
1030919038 7:115357014-115357036 ATGAATTATTTGATGCTAGAGGG + Intergenic
1031200747 7:118682216-118682238 ATGAATAAATTCATGGGAGGAGG + Intergenic
1031828723 7:126599952-126599974 ATGAATGGATGAATGGTGGATGG + Intronic
1032725212 7:134584556-134584578 ATGGATAAATGGATGGAAGCAGG + Intergenic
1033125136 7:138700702-138700724 ATGGATGGATGGATGGCAGATGG + Intronic
1033174838 7:139114353-139114375 ATGAATAGATGTATGGAAGTGGG - Intergenic
1033316709 7:140303421-140303443 ATAACCAAATGGATGGGAGACGG + Intronic
1034043599 7:147905198-147905220 ATAGACAAATGGATGGGAGAAGG - Intronic
1034604844 7:152302634-152302656 ATGAATGAATGAATGAAAGAAGG - Intronic
1034883607 7:154780840-154780862 ATGAATAGATGGATGGGTGATGG + Intronic
1034883631 7:154780968-154780990 ATGAATAGATGGATGGTTGATGG + Intronic
1034883634 7:154780991-154781013 ATGAGTGAATGGATGGATGATGG + Intronic
1035288524 7:157821985-157822007 ATGAGTAGATGGATGGATGATGG - Intronic
1035288644 7:157822822-157822844 ATGGATAGATGGATAGTGGATGG - Intronic
1035523738 8:295484-295506 ATAAATAGATGGATGATGGATGG - Intergenic
1037273519 8:17155736-17155758 AAGAATAAATAGTTGGTGGAAGG + Intergenic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037598690 8:20375276-20375298 ATGGATGGATGGATGGTGGATGG - Intergenic
1037608584 8:20457811-20457833 ATGGATAGATGGATGGAAGCGGG - Intergenic
1037631324 8:20659145-20659167 ATGGAAATATGGATGGTATAGGG - Intergenic
1038120468 8:24608692-24608714 ATGAATGAATGAATGGACGAAGG - Intergenic
1038325129 8:26567231-26567253 ATGGATAGATGGATGATGGATGG - Intronic
1038325132 8:26567250-26567272 ATAAATGAATGGGTGGTGGATGG - Intronic
1038325168 8:26567409-26567431 ATGGATGGATGGATAGTAGATGG - Intronic
1038330253 8:26602647-26602669 ATGAATAAATGAACGGATGAAGG - Intronic
1038522665 8:28246733-28246755 ATAAATAGACGGATGATAGATGG + Intergenic
1038572904 8:28678410-28678432 AGGAATAGATTAATGGTAGAAGG + Intronic
1038679426 8:29653070-29653092 ATGAGTAAATGGATGGATGATGG - Intergenic
1039189944 8:34962473-34962495 ATAAATAAATAGAAGGTTGAAGG - Intergenic
1040074092 8:43211983-43212005 AGGATTAAATGGCTGGTAAATGG + Intergenic
1040577023 8:48661578-48661600 TTAAGTAAATGGATGGCAGATGG - Intergenic
1040805124 8:51386616-51386638 GTGGATAAATAGATGATAGATGG + Intronic
1041516695 8:58707581-58707603 TTGAATAAATACATAGTAGAGGG - Intergenic
1041525203 8:58797721-58797743 ATTAATAAATGGATGGCAAGTGG - Intergenic
1041530818 8:58864942-58864964 AAGACTAAATGGATGCTTGATGG + Intronic
1043428533 8:80171827-80171849 ATAAATAACTTGATGGTGGAAGG - Intronic
1043437640 8:80250076-80250098 ATGAATAAGTGGATGAATGAAGG - Intergenic
1044112707 8:88296116-88296138 ATGAATAAATGGATGAATGATGG - Intronic
1044327745 8:90878681-90878703 ATGAATAAATGGATGAATGAAGG + Intronic
1044793150 8:95868524-95868546 TTAAGTAAATGGATGGTAGATGG - Intergenic
1045141438 8:99289049-99289071 ATGAATGAATGAATGAAAGAAGG + Intronic
1045242274 8:100413016-100413038 ATGAATGAATGAATGAAAGAGGG - Intergenic
1045356698 8:101395898-101395920 ATGAAAATAGGGATGGGAGAAGG - Intergenic
1045369255 8:101505186-101505208 ATGAAGAAAAGGATGGGGGAGGG - Intronic
1046343811 8:112895544-112895566 ATGAATAGGTGGATGTAAGATGG + Intronic
1046456474 8:114470842-114470864 ATATATAAAAGGATGGCAGATGG - Intergenic
1046592730 8:116225450-116225472 AGAAATAAATGGAAGGTGGAAGG - Intergenic
1047082464 8:121478459-121478481 ATGAAGAAATGAATGGGAGGGGG + Intergenic
1047228846 8:122978991-122979013 ATGAATAGACGGATGATGGATGG + Intergenic
1047306773 8:123659033-123659055 CTGAATGAATGGATGATGGATGG - Intergenic
1047306780 8:123659071-123659093 ATGGATAGATGGATGATGGATGG - Intergenic
1047306784 8:123659094-123659116 ATGAATGGATGGATGGATGATGG - Intergenic
1047306801 8:123659187-123659209 ATGGATAGATGGATGATGGATGG - Intergenic
1047306820 8:123659286-123659308 ATGGATGAATGGATGATGGATGG - Intergenic
1047306832 8:123659343-123659365 ATGGATGAATGGATGATGGATGG - Intergenic
1047306946 8:123660041-123660063 ATGGATGAATGGATGATGGATGG - Intergenic
1047376967 8:124308587-124308609 ATAAATAAATAAATGGTGGAGGG + Intergenic
1047921253 8:129636783-129636805 ATGAATCAATGAATGATGGAAGG + Intergenic
1048024115 8:130568702-130568724 CTGGATAAATGGATGTTAGATGG + Intergenic
1048059987 8:130909033-130909055 ATGGATGGATGGATGGTGGATGG - Intronic
1048103389 8:131380069-131380091 ATGAATAAATAGATGTTTGTTGG + Intergenic
1048278825 8:133089641-133089663 ATGAATGAATGGCAGGCAGATGG - Intronic
1048289839 8:133172288-133172310 ATGAATGAATGGATGATGGATGG - Intergenic
1048296970 8:133221535-133221557 ATGAATAGGTGGATGATGGATGG + Intronic
1048324984 8:133432031-133432053 ATGAATAAATGAATGTTCTATGG + Intergenic
1048346761 8:133581609-133581631 ATGAATGAATGAATGAAAGAAGG - Intergenic
1048723896 8:137359965-137359987 ATGAATAAATGAATAGAATATGG - Intergenic
1048979784 8:139697087-139697109 GTGAACAGATGGATGGTGGATGG + Intronic
1048989246 8:139751707-139751729 CTGGATGGATGGATGGTAGATGG - Intronic
1048989285 8:139751909-139751931 GTGGATAGATGGATGGTGGATGG - Intronic
1048989302 8:139751990-139752012 ATGGATAGATGGATGGTAGACGG - Intronic
1048989339 8:139752200-139752222 ATGGATGGATGGATGGTAGATGG - Intronic
1048989351 8:139752250-139752272 TTGGATGGATGGATGGTAGATGG - Intronic
1048989360 8:139752292-139752314 GTGGATGGATGGATGGTAGATGG - Intronic
1048989366 8:139752315-139752337 ATGAATGGATGGGTGGTAGATGG - Intronic
1048989386 8:139752402-139752424 ATGGATGGATGGACGGTAGATGG - Intronic
1048989398 8:139752456-139752478 TTGGATAGATGGATGGTAGATGG - Intronic
1048989414 8:139752536-139752558 GTGGATAGATGGATGGTGGATGG - Intronic
1048989430 8:139752618-139752640 ATGGATAGATGGATGGTAGATGG - Intronic
1048989443 8:139752694-139752716 ATGAATGGATGAATGGTAGATGG - Intronic
1048989466 8:139752833-139752855 ATGGATGGATGGATGGTAGATGG - Intronic
1048989491 8:139752941-139752963 ATTGATGGATGGATGGTAGATGG - Intronic
1048989507 8:139753014-139753036 TTGGATGGATGGATGGTAGATGG - Intronic
1048989541 8:139753155-139753177 ATGGATGGATGGATGGTGGATGG - Intronic
1048989552 8:139753205-139753227 TTGGATGGATGGATGGTAGATGG - Intronic
1048989562 8:139753251-139753273 TTGGATGGATGGATGGTAGATGG - Intronic
1048989572 8:139753293-139753315 ATGGATGGATGGACGGTAGATGG - Intronic
1048989584 8:139753335-139753357 ATGGATGGATGGATGGTAGATGG - Intronic
1049042119 8:140120502-140120524 ATGGATAGATGGAGGCTAGATGG - Intronic
1049042168 8:140120758-140120780 ATGAATGGATGGATGTTGGATGG - Intronic
1049042169 8:140120762-140120784 ATGAATGAATGGATGGATGTTGG - Intronic
1049042177 8:140120812-140120834 ATGGATGGATGGATGTTAGATGG - Intronic
1049348179 8:142149990-142150012 ATGGATGGATGGATGGTTGAAGG + Intergenic
1049348396 8:142151241-142151263 ATGGATAAGTGGATGGGTGATGG + Intergenic
1049364258 8:142229114-142229136 ATGGATAAATGGATGGTGGGTGG + Intronic
1049364269 8:142229156-142229178 ATGGATGAATGGAGGGTGGATGG + Intronic
1049364290 8:142229244-142229266 ATGAATGGATGGATGGTGGATGG + Intronic
1049364302 8:142229294-142229316 ATGGATGGATGGATGGTGGATGG + Intronic
1049401470 8:142429473-142429495 ATGGATGGATGGATGATAGATGG - Intergenic
1049464124 8:142743439-142743461 ATGGGTAAATGAATGGGAGATGG + Intergenic
1049582464 8:143418774-143418796 GTGAATAAATGGTGTGTAGATGG - Intergenic
1049582468 8:143418800-143418822 AAGGATATATGGATGGTTGATGG - Intergenic
1050577560 9:7013801-7013823 ATGAAGAAAATGATGCTAGATGG + Exonic
1050691772 9:8235386-8235408 AGGAAGAAAAGGATGGAAGAGGG - Intergenic
1050839339 9:10127635-10127657 AATAATAACAGGATGGTAGAAGG - Intronic
1052642437 9:31186177-31186199 ATGAAGAAGTGAAGGGTAGAGGG - Intergenic
1053487468 9:38470766-38470788 ATGAATAAGTGGATGGATGAAGG - Intergenic
1053802979 9:41775744-41775766 ATGGATGGATGGATGGTGGATGG - Intergenic
1054142280 9:61539362-61539384 ATGGATGGATGGATGGTGGATGG + Intergenic
1054191271 9:61987058-61987080 ATGAATAGATGGATGGATGGTGG - Intergenic
1054462029 9:65470513-65470535 ATGGATGGATGGATGGTGGATGG + Intergenic
1054647097 9:67600659-67600681 ATGAATAGATGGATGGATGGTGG + Intergenic
1054727325 9:68665529-68665551 ATGAATGAATGCATGCTACATGG + Intergenic
1055329885 9:75172836-75172858 ATGAAAAAATGGGTAGTGGATGG + Intergenic
1055527886 9:77153695-77153717 TTGAATGAACGGATGATAGATGG + Intergenic
1055641248 9:78320448-78320470 ATGAATAGATGGGTGGGTGATGG - Intronic
1055730955 9:79278923-79278945 ATGAATTATTTGAAGGTAGATGG + Intergenic
1055817397 9:80222681-80222703 ATGAAGAAATGAGTGGTAGGTGG - Intergenic
1056135482 9:83625918-83625940 ATGGATGGATGGATGGAAGACGG + Intronic
1056986505 9:91368286-91368308 TTAAGTAAATGGATGGCAGATGG + Intergenic
1057082630 9:92184424-92184446 ATGGATAAATGGATGGATAATGG - Intergenic
1057273258 9:93662572-93662594 ATGAACAAATGCATGGTGCATGG + Intronic
1058128325 9:101221898-101221920 AGGATTAAATGAATGGAAGAAGG + Intronic
1059112026 9:111566664-111566686 CTGAATAAATGAATGTTAGAGGG - Intronic
1059249706 9:112877600-112877622 GTTAATGGATGGATGGTAGAGGG - Intronic
1059409101 9:114120926-114120948 ATAAATAAATGAATGGATGATGG + Intergenic
1059409111 9:114120969-114120991 ATGGATGGATGGATGGTGGATGG + Intergenic
1059416513 9:114165934-114165956 ATGGATAGATGGATGGATGATGG - Intronic
1059473643 9:114526314-114526336 ATGAATAGATGACTGGTAGATGG + Intergenic
1059498567 9:114731047-114731069 GTGGATCGATGGATGGTAGAAGG - Intergenic
1059564990 9:115375203-115375225 ATGAATAGATCGACGGTACAAGG + Intronic
1059653717 9:116338190-116338212 AAGAATAAATGGAGGGAGGAGGG - Intronic
1059774150 9:117458233-117458255 TTAAGTAAATGGATGGCAGATGG + Intergenic
1059774252 9:117459367-117459389 ATGAATAAATGTAATGTAGGAGG + Intergenic
1059977191 9:119730126-119730148 ATGGAAAGATGGATGGGAGAAGG + Intergenic
1060165438 9:121410200-121410222 TTAAGTAAATGGATGGTGGATGG - Intergenic
1060871533 9:127045521-127045543 ATAATGAAATGGATGGCAGATGG + Intronic
1061086132 9:128399777-128399799 ATAATTAAATGAATGGTAGATGG + Intergenic
1061244648 9:129395190-129395212 ATGAAAAAATGGATGGAGGATGG + Intergenic
1061244866 9:129396370-129396392 ATGAGAGGATGGATGGTAGATGG + Intergenic
1061245111 9:129397571-129397593 ATGGATAAGGGGATGGTTGAAGG + Intergenic
1061399583 9:130361047-130361069 ATGACTGAATGGATGGTGAATGG - Intronic
1061417482 9:130454941-130454963 ATGGATAGATGGATGATGGATGG - Intronic
1061417498 9:130455025-130455047 ATGAATGGATGGATGATGGATGG - Intronic
1061417499 9:130455029-130455051 ATGGATGAATGGATGGATGATGG - Intronic
1061417513 9:130455109-130455131 ATGAATAAATGGATGATGGATGG - Intronic
1061417529 9:130455215-130455237 ATGAATAGACGGATGGATGATGG - Intronic
1061950533 9:133933543-133933565 ATGGATGGATGGATGGTGGATGG + Intronic
1061950538 9:133933562-133933584 ATGGATGGATGGATGGTGGATGG + Intronic
1061950597 9:133933828-133933850 ATGGATGGATGGATGGTGGATGG + Intronic
1061950625 9:133933937-133933959 ATGGATGGATGGATGGTGGATGG + Intronic
1061980985 9:134103521-134103543 TTGGATGGATGGATGGTAGATGG - Intergenic
1061981029 9:134103735-134103757 ATGGATAGATGGATGCTGGAAGG - Intergenic
1061981051 9:134103842-134103864 ATGGATAGATGGATGCTGGATGG - Intergenic
1061981085 9:134104006-134104028 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981101 9:134104077-134104099 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981184 9:134104430-134104452 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981191 9:134104467-134104489 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981249 9:134104706-134104728 ATGGATGGATGGATGGTGGATGG - Intergenic
1062092317 9:134684933-134684955 ATGGATGAATGGATGGTGGATGG - Intronic
1062092322 9:134684956-134684978 ATTAATGGATGGATGGTGGATGG - Intronic
1062092323 9:134684960-134684982 ATGAATTAATGGATGGATGGTGG - Intronic
1062092328 9:134684987-134685009 ATTAATGGATGGATGGTGGATGG - Intronic
1062092341 9:134685049-134685071 ATGGATGGATGGATGGTGGATGG - Intronic
1062092354 9:134685095-134685117 ATGAATGGATGGATGGTGGATGG - Intronic
1062092368 9:134685157-134685179 ATGAATGGATGGATGGTGGATGG - Intronic
1062092369 9:134685161-134685183 ATGAATGAATGGATGGATGGTGG - Intronic
1062092378 9:134685208-134685230 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092399 9:134685301-134685323 ATGAATGGATGGATGGTGGATGG - Intronic
1062092411 9:134685356-134685378 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092419 9:134685391-134685413 ATTAATGGATGGATGGTGGATGG - Intronic
1062092420 9:134685395-134685417 ATGAATTAATGGATGGATGGTGG - Intronic
1062092471 9:134685629-134685651 ATGCATGGATGGATGGTGGATGG - Intronic
1062092538 9:134685934-134685956 ATGGATGGATGGATGGTGGATGG - Intronic
1062092820 9:134687455-134687477 ATGAATGGATGGATGGATGATGG - Intronic
1062172222 9:135141221-135141243 ATGGATGAATGGATGATGGATGG + Intergenic
1062172231 9:135141274-135141296 ATGGATGAATGGATGATGGATGG + Intergenic
1062172272 9:135141585-135141607 ATGGATGAATGGATGATAGATGG + Intergenic
1062201236 9:135303911-135303933 ATGGATAAATGGAGGGTGGATGG + Intergenic
1062201258 9:135304031-135304053 GTGGATGAATGGATGGTAGGTGG + Intergenic
1062201344 9:135304439-135304461 ATGGATAGATGGATGATGGAGGG + Intergenic
1062205470 9:135334385-135334407 TTGGATAAATGGATGGATGATGG + Intergenic
1062205489 9:135334505-135334527 TTGGATAAATGGATGGATGATGG + Intergenic
1062246702 9:135572276-135572298 ATGCATAAATGGATGGGTGGAGG - Intergenic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1062248010 9:135579607-135579629 AAGAATGGATGGATGGAAGATGG - Intergenic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1203433040 Un_GL000195v1:109223-109245 AGGAATATATGGAGGGCAGAAGG - Intergenic
1185480461 X:442383-442405 ATGGATAGATAGATGATAGATGG - Intergenic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185498480 X:578416-578438 ATGAATAGATAACTGGTAGATGG + Intergenic
1185498671 X:580553-580575 AGGGATAAATAGATGATAGATGG + Intergenic
1185498679 X:580688-580710 ATGGATAAATAGATGATAGATGG + Intergenic
1185498683 X:580749-580771 ATGGATAAATAGATGATAGATGG + Intergenic
1185498684 X:580768-580790 ATGGATAGATAGATGATAGATGG + Intergenic
1185498692 X:580892-580914 ATGGATAAATAGATGATAGACGG + Intergenic
1185498701 X:581035-581057 ATGGATAAATAGATGATAGACGG + Intergenic
1185498708 X:581152-581174 ATGGATAAATAGATGATAGATGG + Intergenic
1185498731 X:581609-581631 ATGAATAGATGAATGACAGATGG + Intergenic
1185543743 X:925356-925378 ATGGATGGATGGATGGTGGATGG + Intergenic
1185543748 X:925375-925397 ATGGATGGATGGATGGTGGATGG + Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185581087 X:1211945-1211967 ATGGATGGATGGATGATAGATGG + Intronic
1185597429 X:1315908-1315930 ATGGATAGATTGATGATAGATGG + Intergenic
1185611452 X:1395783-1395805 ATGTATAGATGGATGGATGATGG + Intergenic
1185616500 X:1424990-1425012 ATGGATGGATGGATGGTAGGTGG - Intronic
1185616512 X:1425037-1425059 ATGGATGGATGGATGGTAGGTGG - Intronic
1185660416 X:1723784-1723806 ATGAATAGATAGATGATAGATGG + Intergenic
1185660425 X:1723929-1723951 ATGAATAGATAGATGATAGATGG + Intergenic
1185744351 X:2560048-2560070 ATGTATATATGGATGATGGATGG + Intergenic
1185744369 X:2560179-2560201 ATGGATATATGGATGATGGATGG + Intergenic
1185762696 X:2700778-2700800 ATAAATGGATGGATGGTAGATGG - Intronic
1185780568 X:2841118-2841140 ATGGATAGATAGATGATAGATGG + Intronic
1185840520 X:3385577-3385599 ATGAATGGATGGATGAAAGACGG + Intergenic
1185842284 X:3403054-3403076 ATAAATAAATGGATGAAGGAAGG - Intergenic
1185876639 X:3707264-3707286 ATAAATAAATGAATGGATGATGG - Intronic
1185883282 X:3759307-3759329 ATGGACAAATTGGTGGTAGATGG - Intergenic
1185883308 X:3759431-3759453 ATGGACAAATTGGTGGTAGATGG - Intergenic
1185883505 X:3761121-3761143 ATGGATACATGCATGGTAGATGG + Intergenic
1185883520 X:3761207-3761229 ATGAATGTATGGATGGATGAGGG + Intergenic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1186001888 X:5021815-5021837 ATGGATAGATGAATGATAGATGG - Intergenic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1186002469 X:5028264-5028286 ATGAATAAATGGATAGGTGATGG + Intergenic
1186041842 X:5487854-5487876 ATAGATAGATGGATGATAGATGG - Intergenic
1186045225 X:5528839-5528861 ATCAATAGATAGATGATAGATGG - Intergenic
1186166638 X:6833425-6833447 ACGAATGAATGGAAGATAGATGG + Intergenic
1186995705 X:15119731-15119753 GTGAAAAAAAGTATGGTAGACGG + Intergenic
1188529483 X:31123624-31123646 ATGCATAAATTGAAGATAGATGG + Intronic
1189194259 X:39139195-39139217 ATGAATAAAAGGAAGTTATAAGG + Intergenic
1190177391 X:48162183-48162205 ATGAATACAGGGAAGGGAGAGGG - Intergenic
1190183424 X:48214037-48214059 ATGAATACAGGGAAGGGAGAGGG - Intronic
1190561185 X:51686910-51686932 ATGAGTAAATGGATGGTGGAGGG - Intergenic
1190563106 X:51706407-51706429 ATGAGTAAATGGATGGTGGAGGG + Intergenic
1190658088 X:52629801-52629823 ATGAATACAGGGAAGGGAGAGGG - Intergenic
1190666510 X:52701032-52701054 ATGAATACAGGGAAGGGAGAGGG + Intronic
1190672908 X:52757378-52757400 ATGAATACAGGGAAGGGAGAGGG - Intronic
1190752650 X:53375606-53375628 ATGAATCAATGGCTTGTGGAGGG + Exonic
1190908823 X:54753797-54753819 AGGAATAAATGGAAGGGAGAGGG + Intronic
1190926217 X:54907616-54907638 ATAAGTAAAGGGATGGTAGATGG - Intergenic
1191866645 X:65709163-65709185 ATAAATAAATGGCTAGTAGTGGG + Intronic
1193441512 X:81544842-81544864 ATAAACAAATGCATGGTAGCAGG + Intergenic
1193859856 X:86651883-86651905 ATGGATCAATGGATGATGGAAGG + Intronic
1193871306 X:86802367-86802389 AAGAGTCAATGGAAGGTAGAAGG - Intronic
1193893004 X:87074656-87074678 ATTAATAAATGGATTGGATATGG + Intergenic
1194258221 X:91661188-91661210 ATGAATGAATGAATGATGGATGG - Intergenic
1196007110 X:110848920-110848942 ATGAATAACTGGGTGGGAGGTGG + Intergenic
1196024808 X:111030609-111030631 ATGAATGAATGGATAGTTGAAGG + Intronic
1196134903 X:112198418-112198440 ATGAATAAATGGCTCGAAGTTGG + Intergenic
1196235356 X:113273879-113273901 ATGAATAAGTGAATGGAAAAAGG + Intergenic
1197104190 X:122694220-122694242 ATGATAAAATGGATGGAAGGAGG + Intergenic
1197357879 X:125459008-125459030 ATGAAGAAATGGAGAGTAAATGG - Intergenic
1197646957 X:129028095-129028117 TTGAATAAAGGGAAGGGAGAGGG - Intergenic
1198059547 X:133031651-133031673 ATGAATGAATGGATGCTTGCTGG - Intronic
1198601328 X:138287126-138287148 ATGAATAAATGAATGTGAAATGG + Intergenic
1199549742 X:149045854-149045876 ATAAGTAAATGGATGGCAGATGG - Intergenic
1199891711 X:152089827-152089849 CTAAGTAAATGAATGGTAGATGG - Intergenic
1200576988 Y:4900694-4900716 ATGAATGAATGAATGATGGATGG - Intergenic
1200781575 Y:7221077-7221099 ATGGATGAATGGATGGATGATGG + Intergenic
1200788722 Y:7281139-7281161 ATAAATAAATGAATGGATGATGG + Intergenic
1201235489 Y:11906555-11906577 ATGAATGAATGGATGAAAGATGG - Intergenic
1201253106 Y:12080514-12080536 ATGACCAAATAGATGATAGAGGG + Intergenic
1201286684 Y:12384955-12384977 ATCGATAAATAGATGATAGATGG + Intergenic
1201736468 Y:17268013-17268035 CAGACTAAATGGATGGGAGATGG + Intergenic
1201917383 Y:19196693-19196715 ATGGATTAATGGATGGATGATGG + Intergenic
1201917648 Y:19199456-19199478 ATGCATAAAAGGATGATAGATGG - Intergenic
1201917651 Y:19199503-19199525 ATGCATAAAAGGATGATAGATGG - Intergenic