ID: 1152303557

View in Genome Browser
Species Human (GRCh38)
Location 17:79508789-79508811
Sequence CCATGTGTCCCCAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 6, 3: 63, 4: 298}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152303542_1152303557 23 Left 1152303542 17:79508743-79508765 CCCCACACACCCCGCACACCCCA 0: 1
1: 12
2: 80
3: 580
4: 2244
Right 1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 63
4: 298
1152303541_1152303557 30 Left 1152303541 17:79508736-79508758 CCGCACACCCCACACACCCCGCA 0: 1
1: 12
2: 89
3: 604
4: 2264
Right 1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 63
4: 298
1152303544_1152303557 21 Left 1152303544 17:79508745-79508767 CCACACACCCCGCACACCCCACA 0: 1
1: 14
2: 99
3: 625
4: 2297
Right 1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 63
4: 298
1152303543_1152303557 22 Left 1152303543 17:79508744-79508766 CCCACACACCCCGCACACCCCAC 0: 1
1: 5
2: 40
3: 194
4: 1164
Right 1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 63
4: 298
1152303546_1152303557 13 Left 1152303546 17:79508753-79508775 CCCGCACACCCCACACACCTGCT 0: 1
1: 2
2: 8
3: 84
4: 701
Right 1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 63
4: 298
1152303548_1152303557 5 Left 1152303548 17:79508761-79508783 CCCCACACACCTGCTGCTGCCAG 0: 1
1: 0
2: 3
3: 65
4: 517
Right 1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 63
4: 298
1152303545_1152303557 14 Left 1152303545 17:79508752-79508774 CCCCGCACACCCCACACACCTGC 0: 1
1: 1
2: 6
3: 104
4: 902
Right 1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 63
4: 298
1152303550_1152303557 3 Left 1152303550 17:79508763-79508785 CCACACACCTGCTGCTGCCAGCA 0: 1
1: 0
2: 7
3: 47
4: 518
Right 1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 63
4: 298
1152303551_1152303557 -4 Left 1152303551 17:79508770-79508792 CCTGCTGCTGCCAGCACAGCCAT 0: 1
1: 0
2: 8
3: 49
4: 449
Right 1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 63
4: 298
1152303549_1152303557 4 Left 1152303549 17:79508762-79508784 CCCACACACCTGCTGCTGCCAGC 0: 1
1: 0
2: 1
3: 45
4: 415
Right 1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 63
4: 298
1152303547_1152303557 12 Left 1152303547 17:79508754-79508776 CCGCACACCCCACACACCTGCTG 0: 1
1: 2
2: 6
3: 101
4: 822
Right 1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG 0: 1
1: 0
2: 6
3: 63
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152303557 Original CRISPR CCATGTGTCCCCAGGGCAGA GGG Intronic
900017883 1:166502-166524 GCCTGTGTCCCCAGGGCCTATGG + Intergenic
900070364 1:766946-766968 GCCTGTGTCCCCAGGGCCTATGG + Intergenic
900318004 1:2069022-2069044 CCACGTGTCCCCGTGGCAGCCGG - Intronic
900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG + Intronic
900584292 1:3424992-3425014 CCCCGTGTCCCCTGGGCAGGCGG - Intronic
900750663 1:4395062-4395084 CAAGGTGTCCCCAGGGGAGCGGG + Intergenic
902436771 1:16403146-16403168 CCACGTGTCTCCAGGGCAGGTGG - Intronic
902545370 1:17186436-17186458 CCCCGTGCTCCCAGGGCAGAGGG + Intergenic
902669717 1:17964637-17964659 CCATGTGTCCTCAGTGCTGAGGG + Intergenic
903028913 1:20448877-20448899 CCCATTGTCCCCAGAGCAGAGGG + Intergenic
903174513 1:21572945-21572967 CACTGTGGCCCCAAGGCAGAGGG - Intronic
903295933 1:22343053-22343075 CCAGGTGTCCCGAGGGCTGCTGG - Intergenic
903319769 1:22535657-22535679 CCATGTGGCCCCAGTGGAGTTGG + Intergenic
903859086 1:26354394-26354416 GCATCCTTCCCCAGGGCAGAGGG - Intergenic
905797592 1:40824240-40824262 CTACCTTTCCCCAGGGCAGAAGG - Exonic
906047463 1:42843065-42843087 TCAATTGTCCCCAGGCCAGAAGG + Exonic
906607761 1:47183488-47183510 CCCTGTGCCCACAGGGCAGCTGG - Intergenic
907276115 1:53317413-53317435 CCCTGGGGCCCCAGCGCAGATGG + Intronic
907850167 1:58248507-58248529 AGAGGTGTTCCCAGGGCAGAGGG - Intronic
908584817 1:65556141-65556163 CCATGTCTTCACATGGCAGAAGG - Intronic
908932554 1:69334448-69334470 GCATGTGTCCCCAGGGCCCAAGG - Intergenic
910083060 1:83364732-83364754 CCATGTGTCTGCAGGTCAGAGGG - Intergenic
913319667 1:117579383-117579405 CCATGTTTCCCCCAGGCTGAGGG - Intergenic
915947277 1:160162693-160162715 CCAAATGTCCCCAGGGAAGGGGG + Intronic
919739480 1:200973413-200973435 CCCTCTGTCCCCAGAGCAGCTGG + Intronic
920068706 1:203287436-203287458 CCCTCTGTCCCCAGGGGAGTGGG + Intergenic
920416839 1:205804551-205804573 CCAAGTTGCTCCAGGGCAGATGG - Intronic
922105727 1:222512369-222512391 GCCTGTGTCCCCAGGGCCTATGG + Intergenic
922266070 1:223985000-223985022 GCCTGTGTCCCCAGGGCCTATGG + Intergenic
924347909 1:243089939-243089961 GCCTGTGTCCCCAGGGCCTATGG + Intergenic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
1066728445 10:38414967-38414989 GCCTGTGTCCCCAGGGCCTATGG - Intergenic
1067352925 10:45493373-45493395 CCTTGTGACCCCAGGAGAGATGG + Intronic
1067541888 10:47160797-47160819 CCATGGGTCCCCAGGGGCCATGG - Intergenic
1068717659 10:60206049-60206071 CCTTGGGTTCCCAGGGCAGCTGG - Intronic
1068809677 10:61241821-61241843 GCATATGTCCCCATGGCAGGGGG - Intergenic
1069641359 10:69957683-69957705 CCATGGCTCCCCAGAGCACAGGG + Intronic
1069840469 10:71336448-71336470 AAATGTTTCCCCAGGGCAGCCGG + Intronic
1069895992 10:71680343-71680365 TTAGGTGCCCCCAGGGCAGAAGG + Intronic
1071484005 10:86085875-86085897 CCATGGGTCCCGATGGCAGTGGG - Intronic
1073060230 10:100729544-100729566 ACCGGTGTCCCCAGGCCAGAGGG - Intergenic
1073184506 10:101607611-101607633 CTCTGAGTCCCCAGGGCATAGGG + Intronic
1074093452 10:110285698-110285720 CCATGTGGCCTAAGGGCAGCAGG - Exonic
1075667608 10:124242407-124242429 CCATGTTGCCCCAGTGCAGCTGG + Intergenic
1076177744 10:128381373-128381395 CCATGTGTACCAAGGGAGGAGGG - Intergenic
1076444848 10:130507385-130507407 CCATGTGGCCCCAGAGGAGGAGG + Intergenic
1076514088 10:131033429-131033451 CCATGTGCTCCCAGGAGAGACGG - Intergenic
1076830270 10:132990992-132991014 CCGTGTGTTTCCCGGGCAGATGG + Intergenic
1076974485 11:161698-161720 GCCTGTGTCCCCAGGGCCTATGG + Intergenic
1077199452 11:1298228-1298250 CCATGTGTGCCCAGGAGATACGG - Intronic
1077326263 11:1965378-1965400 CCAGATGACCCCAGGGCAGCTGG + Intronic
1077409549 11:2397113-2397135 CCCTGGGACCCCAGGGCAGAAGG - Exonic
1078148195 11:8736594-8736616 TCATGTGTCCCCTGGCAAGAGGG - Intronic
1078338892 11:10485115-10485137 ACAGGGGACCCCAGGGCAGAGGG - Intronic
1078468977 11:11571908-11571930 CTGTGTTTCCCCAGGGCAGAGGG - Intronic
1079095783 11:17509446-17509468 GCCTGTGTCCCCAGTGCGGAAGG + Exonic
1079864281 11:25715967-25715989 AAATGAGTCCCCAGTGCAGAAGG - Intergenic
1081682649 11:45019165-45019187 CCACGTGTCCCCAGGCCTCAGGG - Intergenic
1084462583 11:69304134-69304156 CTCTGTGTCCCCAGAGCTGAGGG - Intronic
1084576625 11:69992815-69992837 GCATGTGTGCCCAGTGCTGAAGG - Intergenic
1084670674 11:70604887-70604909 CCTTGTGTGGCCAGTGCAGATGG - Intronic
1087013942 11:93538387-93538409 CCCTGTGCCACCAGGGAAGAGGG + Intronic
1089247946 11:117136366-117136388 CCATGAGACCCCAGGGGAAAGGG + Intergenic
1089258768 11:117208195-117208217 CCATGAGACCCCAGGGGAAAGGG - Intronic
1089332445 11:117699412-117699434 CGATGTCACCCCAGAGCAGAGGG + Intronic
1089572602 11:119420360-119420382 GCAGGTCTCCCGAGGGCAGAAGG - Exonic
1090872727 11:130762511-130762533 CCAGGTGGTCCCAGGGCAAAGGG - Intergenic
1091140713 11:133232111-133232133 CCATATGCCCCCATAGCAGAAGG + Intronic
1091170589 11:133516650-133516672 CTCAGTGTCCCCAGGGTAGATGG + Intronic
1202809244 11_KI270721v1_random:20557-20579 CCAGATGACCCCAGGGCAGCTGG + Intergenic
1091699568 12:2650919-2650941 CCTAGAGGCCCCAGGGCAGAGGG + Intronic
1091994555 12:4982941-4982963 CCATGGGCCCCCAAGGCAGGGGG - Intergenic
1092067281 12:5601963-5601985 CCAGGTATCCCCAAGGCAGGGGG + Intronic
1092208752 12:6632835-6632857 GAATGTGGCCCCTGGGCAGAAGG - Intronic
1092395091 12:8118914-8118936 CCATGTCTTCACATGGCAGAAGG - Intergenic
1096578649 12:52570338-52570360 GCATGTTGCCACAGGGCAGAGGG - Intronic
1099990706 12:89718002-89718024 CCATGTGAGGACAGGGCAGAAGG - Intergenic
1101229357 12:102724168-102724190 CCATGTGTCTCCAAGCCATAAGG + Intergenic
1101823294 12:108200851-108200873 CTAGGCTTCCCCAGGGCAGAAGG - Intronic
1102056133 12:109897960-109897982 TGTTGTGTCCCCAGTGCAGAGGG - Intergenic
1105434650 13:20365996-20366018 TCATGTCTCCACAGAGCAGAGGG - Intergenic
1110272343 13:73604926-73604948 ACAAATGGCCCCAGGGCAGATGG + Intergenic
1113311453 13:109137216-109137238 ACATGTGTCCCAAGGGAAGGAGG + Intronic
1114278617 14:21169847-21169869 CCAGGGGTTCCCAGGGAAGAGGG - Intergenic
1116814306 14:49569436-49569458 CCATGTCATCCCATGGCAGAAGG + Intergenic
1119660819 14:76450472-76450494 CCTTGAGTTCCCAGGGTAGATGG + Intronic
1120015657 14:79470430-79470452 CCATGTTTTCACATGGCAGAAGG + Intronic
1120479994 14:85037593-85037615 CTATGTACCTCCAGGGCAGAAGG + Intergenic
1121957627 14:98228515-98228537 CCAGGACTCCCCAGGGCAGGCGG + Intergenic
1122206103 14:100148812-100148834 GCACTTGTCCCCAGGGCAGGAGG - Intronic
1122855044 14:104556079-104556101 AGCTGTGACCCCAGGGCAGATGG - Intronic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1123036172 14:105472865-105472887 CCGTGTGTCTCCAGGGCACCTGG + Intergenic
1123116308 14:105895701-105895723 CCGGGTTTCCCCAGGCCAGATGG - Intergenic
1123469580 15:20540289-20540311 CAATGTCTCCTCATGGCAGAAGG + Intronic
1123472231 15:20563789-20563811 CAATGTATCCTCATGGCAGAAGG - Intergenic
1123645771 15:22436564-22436586 CAATGTATCCTCATGGCAGAAGG + Intergenic
1123648482 15:22460410-22460432 CAATGTCTCCTCATGGCAGAAGG - Intronic
1123667081 15:22616441-22616463 CAATGTGTCCTCACGGCAGAAGG + Intergenic
1123682830 15:22775004-22775026 TTATGTATCCTCAGGGCAGAAGG + Intronic
1123708162 15:22965782-22965804 CCTGGTGTCCCCAGAGCAGCAGG + Intronic
1123729858 15:23135275-23135297 CAATGTCTCCTCATGGCAGAAGG + Intronic
1123732536 15:23158780-23158802 CAATGTATCCTCATGGCAGAAGG - Intergenic
1123748028 15:23332757-23332779 CAATGTCTCCTCATGGCAGAAGG + Intergenic
1123750670 15:23356162-23356184 CAATGTGTCCTCATGGCAGAAGG - Intronic
1123762799 15:23445817-23445839 CAATGTATCCTCAGGGCAGAAGG + Intronic
1124280393 15:28356609-28356631 CAATGTCTCCTCATGGCAGAAGG + Intergenic
1124283040 15:28380078-28380100 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124299659 15:28531535-28531557 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124302305 15:28555003-28555025 CAATGTCTCCTCATGGCAGAAGG - Intergenic
1124320923 15:28711009-28711031 CAATGTGTCCTCACGGCAGAAGG + Intronic
1124334578 15:28847527-28847549 TCATGTATCCTCAGGGCAGAAGG + Intergenic
1124481571 15:30084346-30084368 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124488028 15:30136442-30136464 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124522020 15:30412848-30412870 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124536645 15:30553370-30553392 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124543117 15:30605419-30605441 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124563068 15:30792861-30792883 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1124755499 15:32401879-32401901 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124762008 15:32454222-32454244 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124776621 15:32594846-32594868 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124960222 15:34388338-34388360 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124976851 15:34534559-34534581 CAATGTGTCCTCATGGCAGAAGG + Intronic
1125087561 15:35748143-35748165 CCATGTGTGCACAGGGCCCAGGG + Intergenic
1125479819 15:40072384-40072406 CCAGTGGTCCCCAGGGCCGAAGG - Intergenic
1125603735 15:40928769-40928791 CCACGCGTCCCCAGCGCAGCAGG - Intergenic
1126067862 15:44839703-44839725 CCCTGGGTCCCCAGGGAGGAGGG - Intergenic
1126091966 15:45060872-45060894 CCCTGGGTCCCCAGGGAGGAGGG + Intronic
1129036972 15:72656089-72656111 CAATGTGTCCTCATGGCAGAAGG - Intronic
1129212915 15:74081136-74081158 CAATGTGTCCTCATGGCAGAAGG + Intronic
1129397487 15:75259950-75259972 CAATGTGTCCTCATGGCAGAAGG - Intronic
1129401096 15:75284227-75284249 CAATGTGTCCTCATGGCAGAAGG - Intronic
1129474696 15:75776935-75776957 CTATGTGTCCTCATGGCAGAAGG - Intergenic
1129730052 15:77925452-77925474 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1129838465 15:78728535-78728557 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1130260117 15:82348036-82348058 CAATGTGTCCTCATGGCAGAAGG + Intronic
1130268613 15:82431397-82431419 CAATGTGTCCTCATGGCAGAAGG - Intronic
1130281115 15:82520972-82520994 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1130472486 15:84237152-84237174 CAATGTGTCCTCATGGCAGAAGG - Intronic
1130479978 15:84351723-84351745 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1130484207 15:84389303-84389325 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1130491792 15:84436406-84436428 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1130503407 15:84515446-84515468 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1130543904 15:84840858-84840880 CCATGTCTCCGCCGGGCAGGGGG - Exonic
1130594783 15:85241789-85241811 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1131003527 15:88957071-88957093 ACATGTGTTCCCTTGGCAGATGG - Intergenic
1132206900 15:99992689-99992711 CCAAGTGTCCCCATGGCAGGAGG + Intronic
1132414100 15:101608404-101608426 CTGAGTGCCCCCAGGGCAGAAGG - Intergenic
1132433765 15:101780655-101780677 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1132600634 16:771058-771080 CCCTGTTCCCCCAGGACAGAGGG - Intronic
1132605119 16:790414-790436 ACAAGGGTCCCCAGGGCGGAAGG - Intronic
1132659737 16:1055969-1055991 CCATGGGACCCAAGGTCAGAGGG + Intergenic
1133340136 16:5030644-5030666 CCCAGTCTCCCCAGGGCAGCCGG + Intronic
1133805776 16:9125130-9125152 CTGGGTGTCCCCAGGGCACAAGG - Intergenic
1135671409 16:24378637-24378659 CCAGGTGTCCCAAGGGCTAAAGG + Intergenic
1136053390 16:27669675-27669697 CCATCTGTCCTAGGGGCAGAGGG - Intronic
1136470049 16:30473891-30473913 CCAAGGGGCCCCAAGGCAGAGGG - Intronic
1136555420 16:31004918-31004940 CCATCTGTCAGCAGGACAGAAGG - Intronic
1137759748 16:50930829-50930851 CCAAGAGTCCCCAGGAGAGAGGG - Intergenic
1138009480 16:53364065-53364087 CAATGTATCCTCATGGCAGAAGG + Intergenic
1138514223 16:57527080-57527102 CCAGGTCACCCCAGGGAAGAGGG + Intronic
1139340504 16:66265022-66265044 CCATGGGACTCCAGGGGAGAAGG + Intergenic
1140974472 16:80045711-80045733 CTTTGTGTCCCCAGTGAAGAGGG + Intergenic
1141135249 16:81460526-81460548 CCAAGTGTGCCCAGGACTGAGGG - Intronic
1142167121 16:88598064-88598086 CCATGTTTACCCAGGCCTGATGG - Intronic
1142445781 16:90135960-90135982 GCCTGTGTCCCCAGGGCCTATGG - Intergenic
1142461735 17:99511-99533 GCCTGTGTCCCCAGGGCCTATGG + Intergenic
1148227507 17:45909194-45909216 GCATCTGTCCCCCGGGCACAGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151068636 17:71182234-71182256 CCCTGTTTGCCCAGGGCTGAGGG - Intergenic
1151757555 17:76083315-76083337 CCATGTGTACCAAGAGCAGCAGG - Exonic
1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG + Intronic
1152416105 17:80163150-80163172 CCCTGTGTCCCAAAGACAGAAGG + Intergenic
1152963593 18:95951-95973 CCAGGTGACCCCAGCGCAGGAGG - Intergenic
1153103206 18:1497650-1497672 CCCTGGGTCACAAGGGCAGAGGG + Intergenic
1153647049 18:7204836-7204858 CCAAGTCTCCCCACTGCAGAGGG + Intergenic
1156405753 18:36781224-36781246 CCATGTGACCCCAGGCCAAGGGG - Intronic
1158897349 18:61927512-61927534 CCAGAAGACCCCAGGGCAGATGG - Intergenic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160403366 18:78628018-78628040 GCATGTGGCCCGAGGGCTGACGG - Intergenic
1160651434 19:231875-231897 GCCTGTGTCCCCAGGGCCTATGG + Intergenic
1161009720 19:1954399-1954421 CCCTGCGGCCCCAGGTCAGAGGG + Intronic
1161237066 19:3203587-3203609 CCCAGTGTCCACAGGGCCGAGGG + Intronic
1161267447 19:3370885-3370907 CGCTGTGTGCTCAGGGCAGATGG - Intronic
1161313946 19:3609199-3609221 GCAGGTGTGCCCAGGGCAGGGGG - Intergenic
1161474315 19:4475658-4475680 CCATGTGTCCACAGTGCCCAGGG - Intronic
1161592832 19:5136533-5136555 AGATGTGCCCCCGGGGCAGATGG + Intronic
1161854282 19:6754516-6754538 TCATGGTTCCCCAGGGAAGAAGG - Intronic
1162027972 19:7904870-7904892 CCAGGTGTCCCCAGGTCAGGTGG - Intronic
1162046203 19:8002071-8002093 TCAGGTGTCCACTGGGCAGAGGG - Intronic
1162736094 19:12747954-12747976 CCATCTGCAGCCAGGGCAGAGGG - Exonic
1162844835 19:13384320-13384342 CCAAGGGTCCCCAGTGGAGAGGG + Intronic
1162898307 19:13778565-13778587 CCAGCTGTCCCCTGGGCACATGG - Intergenic
1163266232 19:16224198-16224220 ACAAGAGTCCCCAGGGGAGAGGG - Intronic
1163611386 19:18303650-18303672 TCCTGTGTCCCCTGGGCACAGGG + Intergenic
1164148856 19:22531856-22531878 CCATGCGTCCTCACGGCAGAAGG + Intronic
1164155911 19:22596880-22596902 CAATGAGTCCTCATGGCAGAAGG - Intergenic
1164639461 19:29813072-29813094 CCATGTGACCCAGGGGGAGAAGG - Intronic
1165010260 19:32840821-32840843 CCATGTGTTCCCAGGAGAGAGGG - Intronic
1165248754 19:34513521-34513543 CCCAGTGTCCCCAAGGCTGAAGG - Intergenic
1165273902 19:34732525-34732547 CCCAGTGTCCCCAAGGCTGAAGG + Intergenic
1166357036 19:42233313-42233335 CCCACTGTCCCCAGGGAAGATGG + Exonic
1167141085 19:47651214-47651236 CCAGGTGAGCCCAGGGCTGAGGG - Intronic
1167658368 19:50780979-50781001 ACATTGTTCCCCAGGGCAGAGGG - Intergenic
925001472 2:406383-406405 CCATGTGTCCTGAGGCCTGAAGG - Intergenic
925666090 2:6257942-6257964 CCCTGTATCCCCAGGGCTCAGGG + Intergenic
926698212 2:15785238-15785260 CCCTGTGTGCCGAGGGCAGCGGG + Intergenic
926762748 2:16293594-16293616 CCATCTGTCCACAGGTCAGTGGG - Intergenic
926883719 2:17577661-17577683 CCCCTGGTCCCCAGGGCAGATGG - Intronic
927144447 2:20153338-20153360 CTCTGTGTCCCCAGGGCCTATGG - Intergenic
927720327 2:25378135-25378157 CCCTCTCTCCCCGGGGCAGAAGG - Intronic
929116548 2:38449245-38449267 ACCTGTGTTCCCAGGGAAGAGGG - Intergenic
930612270 2:53555640-53555662 CCGGGTGTCTGCAGGGCAGAGGG + Intronic
930837329 2:55808159-55808181 CCAAGTGTCCCCTGGGTAGGTGG + Intergenic
931973705 2:67619285-67619307 CCATCTCTCTCCTGGGCAGATGG - Intergenic
933209347 2:79549021-79549043 TTATGTGTCCACAGGGCATACGG + Intronic
934976152 2:98803925-98803947 CCATGTGTCCCCAGGGCCTGGGG - Intronic
935595858 2:104876966-104876988 CCATCTGCCCCCAAGGGAGAAGG + Intergenic
937304745 2:120864400-120864422 CCATGTGTCTCGATGGCTGAAGG + Intronic
937955289 2:127418701-127418723 CCAAGGGTCCCCAGGGCCCAGGG + Intronic
940035313 2:149306628-149306650 CCAACTGTCACCAGGTCAGATGG - Intergenic
942351560 2:175058187-175058209 CCATGTTATCCCAGGGCACAGGG - Intergenic
946291874 2:218751709-218751731 ACATTTGTCCCCAGGGGAGGTGG - Exonic
947739769 2:232479792-232479814 TCACGGGTCCCCAGGGCAGGCGG - Intergenic
948362937 2:237435440-237435462 CCATGGGGCCCCAGAGCAGGTGG + Intergenic
948519810 2:238528841-238528863 CCATTGGTCCCCAGCACAGAGGG - Intergenic
1171773583 20:29346005-29346027 CCCTGTGTCCCCAAAGGAGAAGG - Intergenic
1171902768 20:30872481-30872503 CCCTGTGTCCCCGAGGGAGAAGG + Intergenic
1174883045 20:54302096-54302118 CCTTGGGTACCCAGGACAGAGGG + Intergenic
1175252276 20:57616773-57616795 TCAGGTGTCCTCAGGGCAGAGGG + Intronic
1175814376 20:61875892-61875914 CCCTCTCTCCCCAGGGCAGGCGG - Intronic
1177775056 21:25558787-25558809 GGATGTGTCTCCAGGGCTGATGG - Intergenic
1178514616 21:33236250-33236272 CCTAGAGTCACCAGGGCAGAGGG - Intronic
1178705064 21:34866180-34866202 CTCTGAGCCCCCAGGGCAGACGG - Intronic
1179308394 21:40175531-40175553 CCATGTCCTCCCGGGGCAGAAGG + Intronic
1179909247 21:44439198-44439220 CTGTGTGTCCCCAGGGCTGCAGG + Intronic
1180717539 22:17882016-17882038 CCATGGGTCACCTGGGCACAGGG - Intronic
1182280513 22:29215453-29215475 CCATGGGTGTCCAGGGCAGTGGG + Intronic
1183697602 22:39432045-39432067 CCATGTTTCCCCGGGGCTGTGGG - Intronic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
1185163265 22:49242522-49242544 GCATCTCTCCCCAGGGAAGAAGG + Intergenic
1185333269 22:50261021-50261043 CCGTGGGTCCCCAGGGGAGAAGG - Intronic
949965882 3:9355860-9355882 CTATGTCACCCCACGGCAGAAGG + Intronic
950100239 3:10352258-10352280 CCCTGTGTACCCTGTGCAGAGGG + Intronic
950424167 3:12915623-12915645 CCATGTGTCCCAGGTGCAGAAGG - Exonic
950459114 3:13110700-13110722 CCCTGTGTCCCCAAGGTAGCAGG - Intergenic
952316837 3:32238885-32238907 GCCTGTGTCCCCAGGGCGCAGGG + Exonic
953666327 3:44928822-44928844 CCTTGAGCCCCCAGGGCAGCAGG - Intronic
953711399 3:45274029-45274051 CTATGTATCCCAAGGGCAGAGGG + Intergenic
953716397 3:45320052-45320074 CCGATTGTCCCCAGTGCAGATGG + Intergenic
954129367 3:48552287-48552309 CCCTGAGTCCCAAGGGCAGTCGG - Intronic
954361394 3:50124605-50124627 CCAGCTGGTCCCAGGGCAGAGGG - Intergenic
954706185 3:52481794-52481816 CAGAGTGTCCCCAGGGCACAAGG - Intronic
955952412 3:64255594-64255616 CCATAAGGCCTCAGGGCAGATGG + Intronic
960913708 3:122676177-122676199 CCATGTCTTCCTATGGCAGAAGG + Intergenic
961593198 3:127996196-127996218 CCCTGGGGCCCCAGGACAGATGG - Intergenic
961777748 3:129301787-129301809 CCATGTGTTCCCTGAGCACAGGG - Intronic
966260813 3:177976675-177976697 CCCTGTGCCCCCATGGCAGTTGG - Intergenic
967119635 3:186371388-186371410 CCATGTCACACAAGGGCAGATGG - Intergenic
967931890 3:194695910-194695932 GCTGGTGTCCCCAGGGCAGTGGG - Intergenic
967952781 3:194853546-194853568 CAATTCCTCCCCAGGGCAGAGGG + Intergenic
968366396 3:198188090-198188112 GCCTGTGTCCCCAGGGCCTATGG - Intergenic
968623456 4:1615095-1615117 CCTTGTGTCCCCAGGTGAGGTGG - Intergenic
968623488 4:1615226-1615248 CCATGTGTGCCCAGGCGGGATGG - Intergenic
968623565 4:1615529-1615551 CCATGTGTGCCCAGGTGGGATGG - Intergenic
968623586 4:1615615-1615637 CCATGTGTGCCCAGGTGGGATGG - Intergenic
968744553 4:2352959-2352981 GCACCTGTCCCCTGGGCAGAAGG + Intronic
969577688 4:8046184-8046206 CGCTGTGTCCCCTGGGCTGATGG + Intronic
969966504 4:11002532-11002554 CTATGAGTGCCCAGGGCACAGGG - Intergenic
971082193 4:23226464-23226486 AGATGTGTGTCCAGGGCAGAAGG + Intergenic
971380115 4:26088931-26088953 TCAGCTGTCCCCAGGTCAGAGGG + Intergenic
973757792 4:54092382-54092404 CCCTGTGTCCCCGGGGCATAGGG - Intronic
976392675 4:84521981-84522003 CCATCTGTCCACAAGGCAGTAGG + Intergenic
976870237 4:89783674-89783696 CCATATTTCCCCATGGCAGAAGG + Intronic
979333526 4:119442777-119442799 GCCTGTGTCCCCAGGGCCTATGG + Intergenic
983422642 4:167539531-167539553 GCATGTGTCTCTAGAGCAGAAGG - Intergenic
986393432 5:7305538-7305560 TCATGTATCCTCAGGGCAGAAGG + Intergenic
987101406 5:14594520-14594542 CACTGTGTCCCCAGGCCAGGGGG + Intronic
987918885 5:24252142-24252164 CCTTGTCTCCACAGGGCAGAAGG + Intergenic
991607940 5:68422078-68422100 CGATGTGTTCTAAGGGCAGAGGG + Intergenic
994669050 5:102744458-102744480 CCATTTTTCCGCAGAGCAGAAGG - Intergenic
996385057 5:122902129-122902151 CCATGAGTACACAGGGAAGATGG - Intronic
996528761 5:124504826-124504848 GCATGTGACCTCAGGGCAGTGGG - Intergenic
998619701 5:143780596-143780618 CCATGTGTCCCCGAAGCAAAGGG - Intergenic
1000008344 5:157208611-157208633 CCATTTGTCACAAGGGCAGTGGG + Intronic
1001199352 5:169701874-169701896 CCCTGTGTCCCTAGGACACATGG + Intronic
1001276949 5:170358149-170358171 ACATTTGTTCCCAGTGCAGAAGG - Intronic
1001527379 5:172438356-172438378 CCAAGGGCCCCCAGGGCAGTGGG - Intronic
1001702624 5:173718321-173718343 CCAAGTGTCCCCTGGGGAGGGGG - Intergenic
1002405638 5:179027955-179027977 CCCAGAGTGCCCAGGGCAGAGGG - Intronic
1002725621 5:181293313-181293335 GCCTGTGTCCCCAGGGCCTATGG - Intergenic
1003005335 6:2375930-2375952 CCAGGTGTCATCAGGGCAGGTGG + Intergenic
1006131931 6:31874814-31874836 CCATGGGTCCTCCGGGCAGGAGG + Exonic
1006466038 6:34195612-34195634 TCATGGGTCCCCACGGTAGAGGG - Intergenic
1006887805 6:37397010-37397032 CCATGTGTCCCAGGGGAGGAAGG - Intergenic
1007915886 6:45561369-45561391 CCATATGAACCAAGGGCAGAGGG + Intronic
1008682666 6:53890489-53890511 CCATGTGGCCCCCGGTCACAAGG + Intronic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1014271724 6:119343945-119343967 GCATGTGTCCGAAGGTCAGAGGG - Intronic
1015283225 6:131456583-131456605 CCGTGGGTCCCAAGAGCAGAAGG + Intergenic
1017206340 6:151807863-151807885 CCGTGTCCCCGCAGGGCAGAAGG - Exonic
1017990240 6:159481262-159481284 CCATGGGTGCCCAGGGCATGGGG + Intergenic
1018862716 6:167722766-167722788 CTCTGGCTCCCCAGGGCAGAGGG + Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1018951624 6:168382015-168382037 CTATGTGTCCACAGGCCACAGGG - Intergenic
1019703914 7:2488429-2488451 CCTTGGGTCCCCAGGGCATTGGG + Intergenic
1019781055 7:2939939-2939961 CCAAGGGTGCCCAGGGGAGAAGG + Intronic
1020370493 7:7427035-7427057 CCATGTGTCTCCAGGGCTGAAGG + Intronic
1021687971 7:23206050-23206072 CCCCGTGTCTGCAGGGCAGAGGG - Intergenic
1022007782 7:26282015-26282037 CCATGTGTCTCCTGGGTAGCTGG - Intergenic
1022452076 7:30524876-30524898 CAATGTGTCCTCATGGCAGAAGG + Intronic
1023079127 7:36511362-36511384 CCAAGTGTGCCCAGGGAAGAAGG + Intergenic
1023677614 7:42646933-42646955 CCATGTCTTCCCATGGCAGAAGG - Intergenic
1023978974 7:45054853-45054875 ACAGGGTTCCCCAGGGCAGATGG + Intronic
1024070516 7:45780916-45780938 GCCTGTGTCCCCAGGGCCTATGG - Intergenic
1024266536 7:47611103-47611125 CTGTGTGTTCCCGGGGCAGAGGG - Intergenic
1024565153 7:50674473-50674495 ACAGGTGTCCCCGAGGCAGAGGG - Exonic
1026741873 7:72983963-72983985 CCATGGGTCCCCAGGGCAGCAGG - Intergenic
1026801717 7:73404388-73404410 CCATGGGTCCCCAGGGCAGCAGG - Intergenic
1027101862 7:75381114-75381136 CCATGGGTCCCCAGGGCAGCAGG + Intergenic
1027299893 7:76820932-76820954 CCATGTGTCTGCAGGTCAGAGGG - Intergenic
1029115770 7:98236369-98236391 CCTTGTTTCCCCTGGACAGAAGG + Intronic
1029457923 7:100680253-100680275 CCCCATGTCCCCAGGGCAGGAGG + Exonic
1030659842 7:112206897-112206919 CCAGGTGGCCCCAGAGCTGAAGG - Intronic
1032047920 7:128625215-128625237 GCCTGTGTCCCCAGGGCCTATGG - Intergenic
1032422474 7:131793715-131793737 CCATGTGACCCCAAAGCAGAAGG - Intergenic
1034353878 7:150435519-150435541 CCTCGTGACCCCAGAGCAGATGG - Intergenic
1035320718 7:158027531-158027553 CCATGTGTTCCCACTGCAGCTGG - Intronic
1035921151 8:3677514-3677536 CCAGGTGTCCCCAGGGTGGCTGG + Intronic
1038491586 8:27975769-27975791 GCCTGAGTCCTCAGGGCAGACGG + Intronic
1044213057 8:89573316-89573338 CCATGTTATCCCATGGCAGAAGG - Intergenic
1045236852 8:100359600-100359622 CCATGTCTCCCCAGGTCTGCTGG - Intronic
1045318722 8:101065204-101065226 ACATCTCTCCCCAGGCCAGAGGG - Intergenic
1045329967 8:101147129-101147151 ACATGTGACCCCAGAGCATATGG - Intergenic
1046095727 8:109558179-109558201 ACATGGGTCCCCTGGGAAGAGGG - Intronic
1047115743 8:121840120-121840142 CCATGTGTGGCCAAGACAGATGG - Intergenic
1049102741 8:140590850-140590872 GGATCTGTCCCCAGGGCAAAGGG - Intronic
1049242322 8:141544253-141544275 CCCTGAGGCCCCAGGTCAGAGGG - Intergenic
1049262176 8:141645711-141645733 CCCTGTGTCCCCACTCCAGAGGG + Intergenic
1049399432 8:142418312-142418334 CCAGGTCTGCGCAGGGCAGAGGG + Intergenic
1049855014 8:144856173-144856195 CCAGGTGTCTCCAGGGCATGAGG + Intergenic
1057266145 9:93619442-93619464 CCAAGTGTCCTCAGGGTGGAGGG + Intronic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1057723659 9:97553624-97553646 CCATGAGACCCCATGCCAGAGGG + Intronic
1058153456 9:101486685-101486707 GCAGGGGTCCCCAGGGCAGCAGG - Intronic
1059693922 9:116713005-116713027 CCATGTGTCCAAAGGTCACATGG - Intronic
1060549045 9:124476608-124476630 CCAAGGGTCCCCAGGGCAAGGGG + Intronic
1060967761 9:127721189-127721211 CCAGGTGTCCCCAGGGCAGGGGG + Intronic
1061065353 9:128274644-128274666 CAATGTATCCACATGGCAGAAGG + Intronic
1061274997 9:129564879-129564901 CCATGTGTCATGATGGCAGATGG + Intergenic
1061922484 9:133789590-133789612 CCCTTTGTCCCCAGAGCTGAAGG - Intronic
1061958782 9:133977505-133977527 CCACGTGTCCCCGGTGCACAAGG - Intronic
1062452231 9:136620597-136620619 CCATGTCTGCCCAGGGCACCTGG + Intergenic
1062750762 9:138250956-138250978 GCCTGTGTCCCCAGGGCCTATGG - Intergenic
1186622207 X:11253232-11253254 CCAGATGTCCCCAGGGCATGGGG + Intronic
1186728549 X:12383308-12383330 CAAAGTATCCCCAGGGGAGAGGG - Intronic
1187685317 X:21810269-21810291 CTGTGTCTCCCCATGGCAGAAGG + Intergenic
1189538427 X:41961192-41961214 GCATGTTGCCCCATGGCAGATGG + Intergenic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1193789541 X:85801132-85801154 CCCAGTGTCACAAGGGCAGAGGG + Intergenic
1199166333 X:144679774-144679796 CCATGAGTCCCCTGGTCACACGG - Intergenic
1199506999 X:148574301-148574323 CCCTTTGTCACTAGGGCAGAAGG - Intronic
1200086956 X:153611647-153611669 CCTTGTGCCCCCAGGGCAGAAGG + Intergenic
1200420231 Y:2957196-2957218 CACTGTGTCACCAGGGCTGAAGG + Intronic
1202366525 Y:24169498-24169520 CAATGTGTCTTCATGGCAGAAGG - Intergenic
1202373873 Y:24215990-24216012 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1202496908 Y:25454130-25454152 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1202504257 Y:25500625-25500647 CAATGTGTCTTCATGGCAGAAGG + Intergenic