ID: 1152306272

View in Genome Browser
Species Human (GRCh38)
Location 17:79522483-79522505
Sequence AAATGTACCCTGAAAATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152306272_1152306275 13 Left 1152306272 17:79522483-79522505 CCAACTATTTTCAGGGTACATTT No data
Right 1152306275 17:79522519-79522541 GATCCTTAGTTGTATTAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152306272 Original CRISPR AAATGTACCCTGAAAATAGT TGG (reversed) Intergenic
No off target data available for this crispr