ID: 1152307250

View in Genome Browser
Species Human (GRCh38)
Location 17:79528560-79528582
Sequence CTTTGCAGATGTAATTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152307245_1152307250 19 Left 1152307245 17:79528518-79528540 CCTCTGAGTAACTCTGAAGAGGA No data
Right 1152307250 17:79528560-79528582 CTTTGCAGATGTAATTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152307250 Original CRISPR CTTTGCAGATGTAATTAAGT TGG Intergenic
No off target data available for this crispr