ID: 1152307342

View in Genome Browser
Species Human (GRCh38)
Location 17:79529025-79529047
Sequence CTCAGGTAGAGGTGGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152307334_1152307342 -2 Left 1152307334 17:79529004-79529026 CCCACATAACAGCACAGCAGCCT No data
Right 1152307342 17:79529025-79529047 CTCAGGTAGAGGTGGGGACATGG No data
1152307335_1152307342 -3 Left 1152307335 17:79529005-79529027 CCACATAACAGCACAGCAGCCTC No data
Right 1152307342 17:79529025-79529047 CTCAGGTAGAGGTGGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152307342 Original CRISPR CTCAGGTAGAGGTGGGGACA TGG Intergenic
No off target data available for this crispr