ID: 1152311950

View in Genome Browser
Species Human (GRCh38)
Location 17:79556886-79556908
Sequence CTGTGTCCAGCTGGTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152311945_1152311950 -10 Left 1152311945 17:79556873-79556895 CCAGGGGTTCACCCTGTGTCCAG No data
Right 1152311950 17:79556886-79556908 CTGTGTCCAGCTGGTGCTCAGGG No data
1152311944_1152311950 -9 Left 1152311944 17:79556872-79556894 CCCAGGGGTTCACCCTGTGTCCA No data
Right 1152311950 17:79556886-79556908 CTGTGTCCAGCTGGTGCTCAGGG No data
1152311940_1152311950 15 Left 1152311940 17:79556848-79556870 CCTCACTAGCAGGGGTTGCTGCT No data
Right 1152311950 17:79556886-79556908 CTGTGTCCAGCTGGTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152311950 Original CRISPR CTGTGTCCAGCTGGTGCTCA GGG Intergenic