ID: 1152314570

View in Genome Browser
Species Human (GRCh38)
Location 17:79572608-79572630
Sequence TGGGGCCACCTCCGGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152314570_1152314583 22 Left 1152314570 17:79572608-79572630 CCCTTTCCCCGGAGGTGGCCCCA No data
Right 1152314583 17:79572653-79572675 ATTTATTAACAAAGGCAGGAGGG No data
1152314570_1152314582 21 Left 1152314570 17:79572608-79572630 CCCTTTCCCCGGAGGTGGCCCCA No data
Right 1152314582 17:79572652-79572674 TATTTATTAACAAAGGCAGGAGG No data
1152314570_1152314581 18 Left 1152314570 17:79572608-79572630 CCCTTTCCCCGGAGGTGGCCCCA No data
Right 1152314581 17:79572649-79572671 AAGTATTTATTAACAAAGGCAGG No data
1152314570_1152314580 14 Left 1152314570 17:79572608-79572630 CCCTTTCCCCGGAGGTGGCCCCA No data
Right 1152314580 17:79572645-79572667 TCTTAAGTATTTATTAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152314570 Original CRISPR TGGGGCCACCTCCGGGGAAA GGG (reversed) Intergenic
No off target data available for this crispr