ID: 1152315029

View in Genome Browser
Species Human (GRCh38)
Location 17:79575160-79575182
Sequence TGATCTAAGAGGAAAGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152315021_1152315029 -6 Left 1152315021 17:79575143-79575165 CCTGGGCCCAGAACCCCTGATCT No data
Right 1152315029 17:79575160-79575182 TGATCTAAGAGGAAAGGCGCTGG No data
1152315015_1152315029 17 Left 1152315015 17:79575120-79575142 CCCCAGGCGATTCCAACATGGAG No data
Right 1152315029 17:79575160-79575182 TGATCTAAGAGGAAAGGCGCTGG No data
1152315017_1152315029 15 Left 1152315017 17:79575122-79575144 CCAGGCGATTCCAACATGGAGCC No data
Right 1152315029 17:79575160-79575182 TGATCTAAGAGGAAAGGCGCTGG No data
1152315014_1152315029 18 Left 1152315014 17:79575119-79575141 CCCCCAGGCGATTCCAACATGGA No data
Right 1152315029 17:79575160-79575182 TGATCTAAGAGGAAAGGCGCTGG No data
1152315020_1152315029 5 Left 1152315020 17:79575132-79575154 CCAACATGGAGCCTGGGCCCAGA No data
Right 1152315029 17:79575160-79575182 TGATCTAAGAGGAAAGGCGCTGG No data
1152315012_1152315029 19 Left 1152315012 17:79575118-79575140 CCCCCCAGGCGATTCCAACATGG No data
Right 1152315029 17:79575160-79575182 TGATCTAAGAGGAAAGGCGCTGG No data
1152315016_1152315029 16 Left 1152315016 17:79575121-79575143 CCCAGGCGATTCCAACATGGAGC No data
Right 1152315029 17:79575160-79575182 TGATCTAAGAGGAAAGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152315029 Original CRISPR TGATCTAAGAGGAAAGGCGC TGG Intergenic
No off target data available for this crispr