ID: 1152316817

View in Genome Browser
Species Human (GRCh38)
Location 17:79585827-79585849
Sequence AAGGTTAGGATGGGCTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152316810_1152316817 7 Left 1152316810 17:79585797-79585819 CCTGATGGGCCGAGAGACAAGAG No data
Right 1152316817 17:79585827-79585849 AAGGTTAGGATGGGCTCCGTGGG No data
1152316811_1152316817 -2 Left 1152316811 17:79585806-79585828 CCGAGAGACAAGAGAAAGTGAAA No data
Right 1152316817 17:79585827-79585849 AAGGTTAGGATGGGCTCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152316817 Original CRISPR AAGGTTAGGATGGGCTCCGT GGG Intergenic
No off target data available for this crispr