ID: 1152318278

View in Genome Browser
Species Human (GRCh38)
Location 17:79593537-79593559
Sequence CAGAGAATGGGGCAGAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152318270_1152318278 10 Left 1152318270 17:79593504-79593526 CCACGGGAGGGTGGGCGTGGAGA No data
Right 1152318278 17:79593537-79593559 CAGAGAATGGGGCAGAGATCTGG No data
1152318262_1152318278 28 Left 1152318262 17:79593486-79593508 CCAGAAAATCTCTCATGGCCACG No data
Right 1152318278 17:79593537-79593559 CAGAGAATGGGGCAGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152318278 Original CRISPR CAGAGAATGGGGCAGAGATC TGG Intergenic
No off target data available for this crispr