ID: 1152320496

View in Genome Browser
Species Human (GRCh38)
Location 17:79606359-79606381
Sequence ATCCACCATCTTTAATTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152320496_1152320511 20 Left 1152320496 17:79606359-79606381 CCCCTAAATTAAAGATGGTGGAT No data
Right 1152320511 17:79606402-79606424 GGGGGACTCCCGTGGTACCCGGG No data
1152320496_1152320508 12 Left 1152320496 17:79606359-79606381 CCCCTAAATTAAAGATGGTGGAT No data
Right 1152320508 17:79606394-79606416 GGCCAAGAGGGGGACTCCCGTGG No data
1152320496_1152320502 0 Left 1152320496 17:79606359-79606381 CCCCTAAATTAAAGATGGTGGAT No data
Right 1152320502 17:79606382-79606404 GGTCCTTTCCCAGGCCAAGAGGG No data
1152320496_1152320504 2 Left 1152320496 17:79606359-79606381 CCCCTAAATTAAAGATGGTGGAT No data
Right 1152320504 17:79606384-79606406 TCCTTTCCCAGGCCAAGAGGGGG No data
1152320496_1152320510 19 Left 1152320496 17:79606359-79606381 CCCCTAAATTAAAGATGGTGGAT No data
Right 1152320510 17:79606401-79606423 AGGGGGACTCCCGTGGTACCCGG No data
1152320496_1152320501 -1 Left 1152320496 17:79606359-79606381 CCCCTAAATTAAAGATGGTGGAT No data
Right 1152320501 17:79606381-79606403 TGGTCCTTTCCCAGGCCAAGAGG No data
1152320496_1152320503 1 Left 1152320496 17:79606359-79606381 CCCCTAAATTAAAGATGGTGGAT No data
Right 1152320503 17:79606383-79606405 GTCCTTTCCCAGGCCAAGAGGGG No data
1152320496_1152320500 -9 Left 1152320496 17:79606359-79606381 CCCCTAAATTAAAGATGGTGGAT No data
Right 1152320500 17:79606373-79606395 ATGGTGGATGGTCCTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152320496 Original CRISPR ATCCACCATCTTTAATTTAG GGG (reversed) Intergenic
No off target data available for this crispr