ID: 1152321020

View in Genome Browser
Species Human (GRCh38)
Location 17:79608943-79608965
Sequence CGCCGGCGGGGTGGGGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321020_1152321037 18 Left 1152321020 17:79608943-79608965 CCCACGCCCCCACCCCGCCGGCG No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321020_1152321028 -10 Left 1152321020 17:79608943-79608965 CCCACGCCCCCACCCCGCCGGCG No data
Right 1152321028 17:79608956-79608978 CCCGCCGGCGCTCAGTGACCTGG No data
1152321020_1152321031 -8 Left 1152321020 17:79608943-79608965 CCCACGCCCCCACCCCGCCGGCG No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321020_1152321033 7 Left 1152321020 17:79608943-79608965 CCCACGCCCCCACCCCGCCGGCG No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321020_1152321039 29 Left 1152321020 17:79608943-79608965 CCCACGCCCCCACCCCGCCGGCG No data
Right 1152321039 17:79608995-79609017 GCCCATACCCGGCTTTCATCAGG No data
1152321020_1152321030 -9 Left 1152321020 17:79608943-79608965 CCCACGCCCCCACCCCGCCGGCG No data
Right 1152321030 17:79608957-79608979 CCGCCGGCGCTCAGTGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321020 Original CRISPR CGCCGGCGGGGTGGGGGCGT GGG (reversed) Intergenic
No off target data available for this crispr