ID: 1152321031

View in Genome Browser
Species Human (GRCh38)
Location 17:79608958-79608980
Sequence CGCCGGCGCTCAGTGACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321006_1152321031 19 Left 1152321006 17:79608916-79608938 CCCCTCCTCCGCCCCCGCCATGC No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321007_1152321031 18 Left 1152321007 17:79608917-79608939 CCCTCCTCCGCCCCCGCCATGCC No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321009_1152321031 14 Left 1152321009 17:79608921-79608943 CCTCCGCCCCCGCCATGCCGCCC No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321008_1152321031 17 Left 1152321008 17:79608918-79608940 CCTCCTCCGCCCCCGCCATGCCG No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321013_1152321031 6 Left 1152321013 17:79608929-79608951 CCCGCCATGCCGCCCCCACGCCC No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321014_1152321031 5 Left 1152321014 17:79608930-79608952 CCGCCATGCCGCCCCCACGCCCC No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321012_1152321031 7 Left 1152321012 17:79608928-79608950 CCCCGCCATGCCGCCCCCACGCC No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321020_1152321031 -8 Left 1152321020 17:79608943-79608965 CCCACGCCCCCACCCCGCCGGCG No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321010_1152321031 11 Left 1152321010 17:79608924-79608946 CCGCCCCCGCCATGCCGCCCCCA No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321017_1152321031 -6 Left 1152321017 17:79608941-79608963 CCCCCACGCCCCCACCCCGCCGG No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321011_1152321031 8 Left 1152321011 17:79608927-79608949 CCCCCGCCATGCCGCCCCCACGC No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321015_1152321031 2 Left 1152321015 17:79608933-79608955 CCATGCCGCCCCCACGCCCCCAC No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321019_1152321031 -7 Left 1152321019 17:79608942-79608964 CCCCACGCCCCCACCCCGCCGGC No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321016_1152321031 -3 Left 1152321016 17:79608938-79608960 CCGCCCCCACGCCCCCACCCCGC No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data
1152321021_1152321031 -9 Left 1152321021 17:79608944-79608966 CCACGCCCCCACCCCGCCGGCGC No data
Right 1152321031 17:79608958-79608980 CGCCGGCGCTCAGTGACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321031 Original CRISPR CGCCGGCGCTCAGTGACCTG GGG Intergenic
No off target data available for this crispr