ID: 1152321033

View in Genome Browser
Species Human (GRCh38)
Location 17:79608973-79608995
Sequence ACCTGGGGCGCCCCTGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 20 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321015_1152321033 17 Left 1152321015 17:79608933-79608955 CCATGCCGCCCCCACGCCCCCAC No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321014_1152321033 20 Left 1152321014 17:79608930-79608952 CCGCCATGCCGCCCCCACGCCCC No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321019_1152321033 8 Left 1152321019 17:79608942-79608964 CCCCACGCCCCCACCCCGCCGGC No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321020_1152321033 7 Left 1152321020 17:79608943-79608965 CCCACGCCCCCACCCCGCCGGCG No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321016_1152321033 12 Left 1152321016 17:79608938-79608960 CCGCCCCCACGCCCCCACCCCGC No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321023_1152321033 0 Left 1152321023 17:79608950-79608972 CCCCACCCCGCCGGCGCTCAGTG No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321022_1152321033 1 Left 1152321022 17:79608949-79608971 CCCCCACCCCGCCGGCGCTCAGT No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321026_1152321033 -5 Left 1152321026 17:79608955-79608977 CCCCGCCGGCGCTCAGTGACCTG No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321011_1152321033 23 Left 1152321011 17:79608927-79608949 CCCCCGCCATGCCGCCCCCACGC No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321017_1152321033 9 Left 1152321017 17:79608941-79608963 CCCCCACGCCCCCACCCCGCCGG No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321013_1152321033 21 Left 1152321013 17:79608929-79608951 CCCGCCATGCCGCCCCCACGCCC No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321021_1152321033 6 Left 1152321021 17:79608944-79608966 CCACGCCCCCACCCCGCCGGCGC No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321024_1152321033 -1 Left 1152321024 17:79608951-79608973 CCCACCCCGCCGGCGCTCAGTGA No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321012_1152321033 22 Left 1152321012 17:79608928-79608950 CCCCGCCATGCCGCCCCCACGCC No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321025_1152321033 -2 Left 1152321025 17:79608952-79608974 CCACCCCGCCGGCGCTCAGTGAC No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321010_1152321033 26 Left 1152321010 17:79608924-79608946 CCGCCCCCGCCATGCCGCCCCCA No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321029_1152321033 -7 Left 1152321029 17:79608957-79608979 CCGCCGGCGCTCAGTGACCTGGG No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321027_1152321033 -6 Left 1152321027 17:79608956-79608978 CCCGCCGGCGCTCAGTGACCTGG No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321009_1152321033 29 Left 1152321009 17:79608921-79608943 CCTCCGCCCCCGCCATGCCGCCC No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data
1152321032_1152321033 -10 Left 1152321032 17:79608960-79608982 CCGGCGCTCAGTGACCTGGGGCG No data
Right 1152321033 17:79608973-79608995 ACCTGGGGCGCCCCTGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321033 Original CRISPR ACCTGGGGCGCCCCTGCAAG AGG Intergenic
No off target data available for this crispr