ID: 1152321037

View in Genome Browser
Species Human (GRCh38)
Location 17:79608984-79609006
Sequence CCCTGCAAGAGGCCCATACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321024_1152321037 10 Left 1152321024 17:79608951-79608973 CCCACCCCGCCGGCGCTCAGTGA No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321026_1152321037 6 Left 1152321026 17:79608955-79608977 CCCCGCCGGCGCTCAGTGACCTG No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321029_1152321037 4 Left 1152321029 17:79608957-79608979 CCGCCGGCGCTCAGTGACCTGGG No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321016_1152321037 23 Left 1152321016 17:79608938-79608960 CCGCCCCCACGCCCCCACCCCGC No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321022_1152321037 12 Left 1152321022 17:79608949-79608971 CCCCCACCCCGCCGGCGCTCAGT No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321020_1152321037 18 Left 1152321020 17:79608943-79608965 CCCACGCCCCCACCCCGCCGGCG No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321032_1152321037 1 Left 1152321032 17:79608960-79608982 CCGGCGCTCAGTGACCTGGGGCG No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321023_1152321037 11 Left 1152321023 17:79608950-79608972 CCCCACCCCGCCGGCGCTCAGTG No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321015_1152321037 28 Left 1152321015 17:79608933-79608955 CCATGCCGCCCCCACGCCCCCAC No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321017_1152321037 20 Left 1152321017 17:79608941-79608963 CCCCCACGCCCCCACCCCGCCGG No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321019_1152321037 19 Left 1152321019 17:79608942-79608964 CCCCACGCCCCCACCCCGCCGGC No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321021_1152321037 17 Left 1152321021 17:79608944-79608966 CCACGCCCCCACCCCGCCGGCGC No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321025_1152321037 9 Left 1152321025 17:79608952-79608974 CCACCCCGCCGGCGCTCAGTGAC No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data
1152321027_1152321037 5 Left 1152321027 17:79608956-79608978 CCCGCCGGCGCTCAGTGACCTGG No data
Right 1152321037 17:79608984-79609006 CCCTGCAAGAGGCCCATACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321037 Original CRISPR CCCTGCAAGAGGCCCATACC CGG Intergenic
No off target data available for this crispr