ID: 1152321274

View in Genome Browser
Species Human (GRCh38)
Location 17:79609972-79609994
Sequence CTCGAGCAGCGCGGCCGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321274_1152321283 -10 Left 1152321274 17:79609972-79609994 CCAGCCCGGCCGCGCTGCTCGAG No data
Right 1152321283 17:79609985-79610007 GCTGCTCGAGGCCCTGGGGGTGG No data
1152321274_1152321287 7 Left 1152321274 17:79609972-79609994 CCAGCCCGGCCGCGCTGCTCGAG No data
Right 1152321287 17:79610002-79610024 GGGTGGCCGAGGCTTCAGAGAGG No data
1152321274_1152321284 -4 Left 1152321274 17:79609972-79609994 CCAGCCCGGCCGCGCTGCTCGAG No data
Right 1152321284 17:79609991-79610013 CGAGGCCCTGGGGGTGGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321274 Original CRISPR CTCGAGCAGCGCGGCCGGGC TGG (reversed) Intergenic
No off target data available for this crispr