ID: 1152321503

View in Genome Browser
Species Human (GRCh38)
Location 17:79610708-79610730
Sequence GGGACCCCGCAGTGGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321503_1152321508 -7 Left 1152321503 17:79610708-79610730 CCCGCCTCCCACTGCGGGGTCCC No data
Right 1152321508 17:79610724-79610746 GGGTCCCATGCGCCCCTCCGCGG No data
1152321503_1152321521 26 Left 1152321503 17:79610708-79610730 CCCGCCTCCCACTGCGGGGTCCC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321503_1152321520 25 Left 1152321503 17:79610708-79610730 CCCGCCTCCCACTGCGGGGTCCC No data
Right 1152321520 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321503 Original CRISPR GGGACCCCGCAGTGGGAGGC GGG (reversed) Intergenic