ID: 1152321504

View in Genome Browser
Species Human (GRCh38)
Location 17:79610709-79610731
Sequence TGGGACCCCGCAGTGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321504_1152321520 24 Left 1152321504 17:79610709-79610731 CCGCCTCCCACTGCGGGGTCCCA No data
Right 1152321520 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data
1152321504_1152321508 -8 Left 1152321504 17:79610709-79610731 CCGCCTCCCACTGCGGGGTCCCA No data
Right 1152321508 17:79610724-79610746 GGGTCCCATGCGCCCCTCCGCGG No data
1152321504_1152321521 25 Left 1152321504 17:79610709-79610731 CCGCCTCCCACTGCGGGGTCCCA No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321504 Original CRISPR TGGGACCCCGCAGTGGGAGG CGG (reversed) Intergenic