ID: 1152321505

View in Genome Browser
Species Human (GRCh38)
Location 17:79610712-79610734
Sequence GCATGGGACCCCGCAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321505_1152321520 21 Left 1152321505 17:79610712-79610734 CCTCCCACTGCGGGGTCCCATGC No data
Right 1152321520 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data
1152321505_1152321521 22 Left 1152321505 17:79610712-79610734 CCTCCCACTGCGGGGTCCCATGC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321505 Original CRISPR GCATGGGACCCCGCAGTGGG AGG (reversed) Intergenic