ID: 1152321506

View in Genome Browser
Species Human (GRCh38)
Location 17:79610715-79610737
Sequence GGCGCATGGGACCCCGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321506_1152321521 19 Left 1152321506 17:79610715-79610737 CCCACTGCGGGGTCCCATGCGCC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321506_1152321520 18 Left 1152321506 17:79610715-79610737 CCCACTGCGGGGTCCCATGCGCC No data
Right 1152321520 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321506 Original CRISPR GGCGCATGGGACCCCGCAGT GGG (reversed) Intergenic