ID: 1152321507 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:79610716-79610738 |
Sequence | GGGCGCATGGGACCCCGCAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1152321507_1152321521 | 18 | Left | 1152321507 | 17:79610716-79610738 | CCACTGCGGGGTCCCATGCGCCC | No data | ||
Right | 1152321521 | 17:79610757-79610779 | CTCCCCCAGCTCAGCCCGATGGG | No data | ||||
1152321507_1152321520 | 17 | Left | 1152321507 | 17:79610716-79610738 | CCACTGCGGGGTCCCATGCGCCC | No data | ||
Right | 1152321520 | 17:79610756-79610778 | CCTCCCCCAGCTCAGCCCGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1152321507 | Original CRISPR | GGGCGCATGGGACCCCGCAG TGG (reversed) | Intergenic | ||