ID: 1152321507

View in Genome Browser
Species Human (GRCh38)
Location 17:79610716-79610738
Sequence GGGCGCATGGGACCCCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321507_1152321521 18 Left 1152321507 17:79610716-79610738 CCACTGCGGGGTCCCATGCGCCC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321507_1152321520 17 Left 1152321507 17:79610716-79610738 CCACTGCGGGGTCCCATGCGCCC No data
Right 1152321520 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321507 Original CRISPR GGGCGCATGGGACCCCGCAG TGG (reversed) Intergenic