ID: 1152321508

View in Genome Browser
Species Human (GRCh38)
Location 17:79610724-79610746
Sequence GGGTCCCATGCGCCCCTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321494_1152321508 24 Left 1152321494 17:79610677-79610699 CCCTCGGGTCAGCCCCGGCCGCG No data
Right 1152321508 17:79610724-79610746 GGGTCCCATGCGCCCCTCCGCGG No data
1152321497_1152321508 11 Left 1152321497 17:79610690-79610712 CCCGGCCGCGCTCAGCAGCCCGC No data
Right 1152321508 17:79610724-79610746 GGGTCCCATGCGCCCCTCCGCGG No data
1152321504_1152321508 -8 Left 1152321504 17:79610709-79610731 CCGCCTCCCACTGCGGGGTCCCA No data
Right 1152321508 17:79610724-79610746 GGGTCCCATGCGCCCCTCCGCGG No data
1152321495_1152321508 23 Left 1152321495 17:79610678-79610700 CCTCGGGTCAGCCCCGGCCGCGC No data
Right 1152321508 17:79610724-79610746 GGGTCCCATGCGCCCCTCCGCGG No data
1152321496_1152321508 12 Left 1152321496 17:79610689-79610711 CCCCGGCCGCGCTCAGCAGCCCG No data
Right 1152321508 17:79610724-79610746 GGGTCCCATGCGCCCCTCCGCGG No data
1152321503_1152321508 -7 Left 1152321503 17:79610708-79610730 CCCGCCTCCCACTGCGGGGTCCC No data
Right 1152321508 17:79610724-79610746 GGGTCCCATGCGCCCCTCCGCGG No data
1152321498_1152321508 10 Left 1152321498 17:79610691-79610713 CCGGCCGCGCTCAGCAGCCCGCC No data
Right 1152321508 17:79610724-79610746 GGGTCCCATGCGCCCCTCCGCGG No data
1152321499_1152321508 6 Left 1152321499 17:79610695-79610717 CCGCGCTCAGCAGCCCGCCTCCC No data
Right 1152321508 17:79610724-79610746 GGGTCCCATGCGCCCCTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321508 Original CRISPR GGGTCCCATGCGCCCCTCCG CGG Intergenic