ID: 1152321510

View in Genome Browser
Species Human (GRCh38)
Location 17:79610729-79610751
Sequence CATGGCCGCGGAGGGGCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321510_1152321528 26 Left 1152321510 17:79610729-79610751 CCATGCGCCCCTCCGCGGCCATG No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321510_1152321529 29 Left 1152321510 17:79610729-79610751 CCATGCGCCCCTCCGCGGCCATG No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321510_1152321521 5 Left 1152321510 17:79610729-79610751 CCATGCGCCCCTCCGCGGCCATG No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321510_1152321520 4 Left 1152321510 17:79610729-79610751 CCATGCGCCCCTCCGCGGCCATG No data
Right 1152321520 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data
1152321510_1152321530 30 Left 1152321510 17:79610729-79610751 CCATGCGCCCCTCCGCGGCCATG No data
Right 1152321530 17:79610782-79610804 TGACCGCCGCAGAGCGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321510 Original CRISPR CATGGCCGCGGAGGGGCGCA TGG (reversed) Intergenic