ID: 1152321511

View in Genome Browser
Species Human (GRCh38)
Location 17:79610736-79610758
Sequence AGGGGGACATGGCCGCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321511_1152321530 23 Left 1152321511 17:79610736-79610758 CCCCTCCGCGGCCATGTCCCCCT No data
Right 1152321530 17:79610782-79610804 TGACCGCCGCAGAGCGAGGCGGG No data
1152321511_1152321529 22 Left 1152321511 17:79610736-79610758 CCCCTCCGCGGCCATGTCCCCCT No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321511_1152321528 19 Left 1152321511 17:79610736-79610758 CCCCTCCGCGGCCATGTCCCCCT No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321511_1152321520 -3 Left 1152321511 17:79610736-79610758 CCCCTCCGCGGCCATGTCCCCCT No data
Right 1152321520 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data
1152321511_1152321521 -2 Left 1152321511 17:79610736-79610758 CCCCTCCGCGGCCATGTCCCCCT No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321511 Original CRISPR AGGGGGACATGGCCGCGGAG GGG (reversed) Intergenic