ID: 1152321512

View in Genome Browser
Species Human (GRCh38)
Location 17:79610737-79610759
Sequence GAGGGGGACATGGCCGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321512_1152321529 21 Left 1152321512 17:79610737-79610759 CCCTCCGCGGCCATGTCCCCCTC No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321512_1152321530 22 Left 1152321512 17:79610737-79610759 CCCTCCGCGGCCATGTCCCCCTC No data
Right 1152321530 17:79610782-79610804 TGACCGCCGCAGAGCGAGGCGGG No data
1152321512_1152321528 18 Left 1152321512 17:79610737-79610759 CCCTCCGCGGCCATGTCCCCCTC No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321512_1152321521 -3 Left 1152321512 17:79610737-79610759 CCCTCCGCGGCCATGTCCCCCTC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321512_1152321533 30 Left 1152321512 17:79610737-79610759 CCCTCCGCGGCCATGTCCCCCTC No data
Right 1152321533 17:79610790-79610812 GCAGAGCGAGGCGGGCGACGAGG No data
1152321512_1152321520 -4 Left 1152321512 17:79610737-79610759 CCCTCCGCGGCCATGTCCCCCTC No data
Right 1152321520 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321512 Original CRISPR GAGGGGGACATGGCCGCGGA GGG (reversed) Intergenic