ID: 1152321513

View in Genome Browser
Species Human (GRCh38)
Location 17:79610738-79610760
Sequence GGAGGGGGACATGGCCGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321513_1152321533 29 Left 1152321513 17:79610738-79610760 CCTCCGCGGCCATGTCCCCCTCC No data
Right 1152321533 17:79610790-79610812 GCAGAGCGAGGCGGGCGACGAGG No data
1152321513_1152321521 -4 Left 1152321513 17:79610738-79610760 CCTCCGCGGCCATGTCCCCCTCC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321513_1152321528 17 Left 1152321513 17:79610738-79610760 CCTCCGCGGCCATGTCCCCCTCC No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321513_1152321530 21 Left 1152321513 17:79610738-79610760 CCTCCGCGGCCATGTCCCCCTCC No data
Right 1152321530 17:79610782-79610804 TGACCGCCGCAGAGCGAGGCGGG No data
1152321513_1152321529 20 Left 1152321513 17:79610738-79610760 CCTCCGCGGCCATGTCCCCCTCC No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321513_1152321520 -5 Left 1152321513 17:79610738-79610760 CCTCCGCGGCCATGTCCCCCTCC No data
Right 1152321520 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321513 Original CRISPR GGAGGGGGACATGGCCGCGG AGG (reversed) Intergenic
No off target data available for this crispr