ID: 1152321514

View in Genome Browser
Species Human (GRCh38)
Location 17:79610741-79610763
Sequence GGGGGAGGGGGACATGGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321514_1152321530 18 Left 1152321514 17:79610741-79610763 CCGCGGCCATGTCCCCCTCCCCC No data
Right 1152321530 17:79610782-79610804 TGACCGCCGCAGAGCGAGGCGGG No data
1152321514_1152321528 14 Left 1152321514 17:79610741-79610763 CCGCGGCCATGTCCCCCTCCCCC No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321514_1152321529 17 Left 1152321514 17:79610741-79610763 CCGCGGCCATGTCCCCCTCCCCC No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321514_1152321533 26 Left 1152321514 17:79610741-79610763 CCGCGGCCATGTCCCCCTCCCCC No data
Right 1152321533 17:79610790-79610812 GCAGAGCGAGGCGGGCGACGAGG No data
1152321514_1152321521 -7 Left 1152321514 17:79610741-79610763 CCGCGGCCATGTCCCCCTCCCCC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321514_1152321520 -8 Left 1152321514 17:79610741-79610763 CCGCGGCCATGTCCCCCTCCCCC No data
Right 1152321520 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321514 Original CRISPR GGGGGAGGGGGACATGGCCG CGG (reversed) Intergenic